Q: reproductive cloning
A: Apart from the natural reproduction of various organisms in our ecosystem, the advent of technology…
Q: explain the rationales of adding chemicals that can affect DNA stability in a polymerase chain…
A: PCR is the polymerase chain reaction that use to amplify the particular sequence of DNA and forming…
Q: 4. Some transposases use extensive DNA replication to leave one copy of the element behind in a…
A: Trnasposases are the enzymes that identify the inverse terminal repeat sequences within the DNA and…
Q: Question 31
A: Restriction endonucleases are the enzymes that are used to cut DNA (deoxyribonucleic acid) at the…
Q: 3. Briefly explain how the Sanger technique for sequencing works.
A: Sanger sequencing, also known as the “chain termination method,” was developed by the English…
Q: 5. If you are able to successfully incorporate foreign DNA to your host organism, what are your…
A: A foreign DNA is a DNA that is transferred into a species from other source and not that of parent.
Q: Which of the following alternative steps cannot be employed in the DNA extraction because it would…
A: You have asked multiple questions. I will answer 1st question, as allowed by guidelines. Asked :…
Q: 3. Why will we put your cheek cells in the InstaGene solution? In other words, why do we want to…
A: DNA isolation is one of the crucial steps in molecular biology and should be performed with care and…
Q: 4. Assume that a new low-calorie sweetener is developed. The structure is novel and is tested with…
A: Any product that is intended for human consumption requires prior approval and usage recommendation…
Q: Explain why phenol:chloroform is used in the isolation of genomic DNA ( What is the end result and…
A: Extraction of genomic DNA is of main importance to study the genetic reasons behind diseases and for…
Q: Methods of gene therapy
A: Note: Since you have posted multiple questions so we will be solving the first question for you. As…
Q: 4. Give the importance of Genomics especially in human. What are the different techniques in…
A: A genome is an organism's whole collection of DNA. The genomic DNA sequence is held within an…
Q: 6. Two possible paint mutations are the substitution of lysine for leucine or the substitution of…
A: Every physiological characteristic or metabolism of our body mainly controlled by proteins. These…
Q: What are the frequency and percentage distribution of amino acids in the polypeptides coded by the…
A: Introduction When a DNA gene is disrupted or damaged in such a way that the genetic message carried…
Q: 7. You are tasked with amplifying a fragment of interest from a sample of genomic DNA by using PCR.…
A: PCR stands for the polymerase chain reaction. It is described as a test that is used to detect the…
Q: 2. What are restriction digestion and gel electrophoresis used for in this cloning series of…
A: Restriction digestion technique is implicated in biotechnology or related field during cloning…
Q: 4. Write the Edman degradation technique used for the sequencing of proteins
A: “Since you have asked multiple questions, we will solve the first question for you. If youwant any…
Q: 10. The three components of a plasmid which are crucial for gene cloning purpose are: 1) 2) 3)
A: Plasmids are a circular, double-stranded DNA of the bacteria and are able to self replicates hence…
Q: 4. Consider that you identified an enzyme in a fungus which can digest plastic. You want to isolate…
A: In genetics, the set of procedures used to do genetic modification in an organism through the…
Q: ) What are the techniques to verify the extracted genome?
A: Genome extraction is a process by which genitic material is extracted from buccal swab, urine, hair…
Q: )A scientist compares the sequence of a disease gene and a healthy gene and finds that these two…
A: The gene is the unit of heredity that is carried out from the parents to the offspring. This…
Q: С 17 Based on the knowledge you gained from the cloning module, which of the bands in the figure is…
A: Agarose gel electrophoresis is a method used in molecular biology to resolve DNA fragments on the…
Q: 1)explain why it is far less important for RNA Polymerase to have proofreading activity than it is…
A: Fidelity of replication is the most important for the very existence of an organism. Besides its…
Q: 6. Why do you think the Ames test is preferable to the use of animal models to screen chemical…
A: Ames test is used to find whether a given chemical causes mutation in the DNA in the animal models.…
Q: 9) Describe the steps required to use sequencing DNA to identify your gene of interest after…
A: DNA sequencing is the process of finding the sequence of the nucleotides on a particular short…
Q: 1. Given the following restriction endonucleases and the sequences of their corresponding…
A: Prokaryotic cells are unicellular organisms that differ from multicellular organisms in composition…
Q: 1. Determine the approximate number of amino acids that would be missing in the telomerase protein…
A: A telomere can be defined as the repetitive sequences on the DNA which is present at the end of the…
Q: 1)Explain why there is a part of the Lacz gene in pUC18119 and also how the natural biochemical…
A: LacZ gene encodes for beta galactosidase enzyme.
Q: 1. What does PCR stand for? 2. Explain the main objective of the PCR technique.
A: PCR It is a technique used in molecular biology which was developed by Kary Mullis, an American…
Q: 9.) Describe the molecular mechanisms of mutagenesis. Consider Inciuding the bases impacted, the…
A: Mutagenesis is the process by which the genetic information of an organism gets changed by mutation.…
Q: 1. Where is the cleavable blocker located on the modified nucleotides used in Illumina sequencing?
A: Illumina sequencing is developed by Solexa and was subsequently acquired by Illumina. This…
Q: 5. Describe the method of random mutagenesis using degenerate oligonucleotide primers 6. What are…
A: We are authorized to answer one question at a time since you have not mentioned which question you…
Q: The authors investigate if the switch from the polymerase to the exonuclease site involves releasing…
A: During DNA replication, accuracy is determined by rate of nucleotide incorporation by DNA…
Q: 5. What are some PROS and Cons of CRISPR? List at least 3 of ceach Pros of CRISPR Cons of CRISPR 6.…
A: “CRISPR” (pronounced “crisper”) stands for Clustered Regularly Interspaced Short Palindromic…
Q: 1. Follow the steps involved in DNA or gene cloning. 2. In what process do bacteria take up the…
A: Genetic engineering is the introduction of foreign DNA into the host genome. It is also employed to…
Q: 3. Explain in your own words the methods used to collect your cheek cells and to extract the DNA. Be…
A: DNA extraction
Q: 1. What is mutation? Explain the random and site-directed mutagenesis methods .Which one is…
A: Since you have posted a question with multiple sub-parts, we will solve first three questions for…
Q: 8. Describe the steps involved in the process of genetic engineering via recombinant DNA technology.…
A: Recombinant DNA TechnologyRecombinant DNA technology alters the phenotype of an organism (host)…
Q: What is the purpose of adding of (a) warm salt water, (b) detergent, and (c) alcohol on the…
A: Extraction of DNA from a banana involves mashing, filtration, precipitation and extraction.
Q: 3). Explain a substitution mutation 4) Explain a deletion mutation 5). Explain an insertion…
A: 3. Substitution mutation: change of a single base causes change of the amino acid.
Q: 3. Identify one advantage an organism might gain from expressing endogenous endonucleases. 4. You…
A: Recombinant DNA (deoxyribonucleic acid) technology is a technique in which DNA sequences are linked…
Q: How is a randomized DNA library created? MARK ALL THAT APPLY. the use of Mn2+ rather than Mg2+ by…
A: DNA libraries are a collection of a large number of various genes of choice kept or stored together…
Q: 1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting…
A: TAS2R38 is a taste receptor gene present in the 7th chromosome of the genome. The length of a gene…
Q: 7. You are preparing a library to sequence two samples, one from a WS and one from a FS, via…
A: Introduction An aligned read is that sequence which has been aligned to a common reference genome.…
Q: 1. List all the differences between the DNA Polymerase Reaction and Polymerase Chain Reaction (PCR)?
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Describe several different DNA repair mechanisms. Which ones contribute to mutations?
A: "Since you have asked multiple questions, we will solve the first question for you. if you want any…
Q: Suggest reasons for why DNA mutations are not all phenotypic.
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: 2. If a selection assay be made to identify cells that have incorporated the recombinant DNA, what…
A:
Q: Make simple steps to extract isolating DNA from strawberries and yeast.
A: Answer
Q: 7. Which of the following base sequences are probably not recognition sites for cleavage by…
A: Restriction endonucleases are the molecular cutters which is used to split DNA in the center but…
Step by step
Solved in 3 steps with 1 images
- 1. Discuss two naturally DNA repair pathways, homologous recombination and non-homolgous end-joining, and how each is utlized in mammalian genome manipulation. 2. Describe and explain how the work of Jinek et al contributed to the adaptation of the naturally occuring CRISPR mechanism to function in genome editing, with reference to the experiment(s) involved. 3. Discuss the advantages of gene silencing compared with genome editing, and briefly describe the two main approaches of gene silencing.1. Briefly explain why the total size of the pMBBS plasmid in the Restriction Enzymes practical is 3000bp (base pairs) 2. Briefly explain why the cut sites on the pMBBS plasmid in each Restriction Enzymes (EcoRI, BamHI, and XhoI) just 1 each 3. Briefly explain what led to the 5 fragments formed which linked to the 500bp, 1000bp, 1500bp, 2000bp, 2500bp sizesChemical Mutagenesis of DNA Bases Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon mutagenesis with (a) HNO2, (b) bromouracil, and (C) 2-aminopurine.
- Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.52.Describe the basic processes of DNA clone by using E.coli 155 1202020155pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
- 5. Consider the following plasmid (size 8000 bp), with restriction sites at the positions indicated: PstI XhoI 7000 8 kb 2000 XhoI Probe 4200 ECORI This plasmid is digested with the enzymes listed below. Indicate how many fragments will be a) generated in each case, and give the sizes of the fragments. PstI XhoI Combination of PstI + XhoI + EcoRI (triple digest) b) Draw the banding pattern you would expect to observe if each of these digestions is loaded into a separate well of an agarose gel, and the fragments separated by electrophoresis. In the first well you load a DNA marker (M) containing fragments with sizes of 1000 bp, 2000 bp, 4000 bp and 8000 bp. This gel is transferred to a membrane in a Southern blot experiment, and hybridised to a c) radioactively labelled 200 bp probe, which anneals to the plasmid DNA at the position indicated on the diagram above. Draw the autoradiographic profile you would expect to observe for the membrane.www D le C 3⁰ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F) in the space provided 1. The name of this process is best known as Rho dependent termination 2. The enzyme C called DNA polymerase incorporates ribonucleotides into B called the mRNA False 3. The DNA region A contains inverted palindrome sequences which results in formation of a stem-loops structure 4. During this process, the structure D called terminating hairpin forms and increases the enzyme affinity which terminates transcriptionI. The DNA template, 3'–CGTTACCCGAGCOCGTACGATTAGG–5', was exposed to a mutagen, resulting in the following three templates. 2. A. 3'–CGTTACCCGAGCCGTAACGATTAGG-5' nserti on leuding to frame shift B. 3-CGTTACCCGATCCGTACGATTAGG–5' Point - Transversin C. 3'-CGTTACCCGAGCCGTTCGATTAGG–5' Transition I. Transcribe and translate each template and write down the primary sequence of the resulting polypeptide/protein. Describe how each of the mutations will affect the final protein product from the corresponding template. N met -gla - Ser- Ala -cys -Stup-d Predict whether gene expression (from initiation of transcription to final protein product) would be faster in a prokaryotic or eukaryotic cell. Explain your answer.
- . Early gene-cloning experiments involved insertion at one restriction site in the vector; for example, the insert would have an EcoRI site at each end, and the vector would be opened at an RI site prior to ligation. Under what circumstances would asymmetric cloning be desirable, with the inset having a different restriction site at each end9. The restriction site sequence for the restriction enzyme Sau3Al and BamHI include four identical bases, making their sticky ends identical as shown in the figure. Let's say you have foreign DNA whose flanking regions were cut with Sau3AI. Also, you want to use a plasmid containing a BamHI restriction site. (1) Would it be possible to ligate the foreign DNA into the BamHI site of the plasmid? Explain. lison Lenharc (2) Would it be possible to cut the ligated sites with Sau3AI? What about BamHI? What problems will you expect if you use BamHI? BamHI Sau3Al G-G-A-T-C-C பர்டிய C-C-T-A-G-G G-A-T-C Hi- 目1目 C-T-A-G C-C-T-A-G C-T-A-G G-A-T-C-C E E G-A-T-C= 10. An ampicillin-resistant, tetracycline-resistant plasmid, pBR322, is cut with Pstl, which cleaves within the ampi resistance gene. The cut plasmid is ligated with Pstl digested Drosophila DNA to prepare a genomic library, and t rcoli K126. Mutation analysis of GCK gene in patients with diabetes revealed a c.114 TàA (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) (5p) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) (10p) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGC ATGGCAGCTCTAATGACAGGATGGTCACCCCTG CTGAGGCCACTCCTGGTCACCATGACAACCACA GGCCCTCTCAGTATCACAGTAAGCCCTGGCAGG AGAATCCCCCACTCCACACCTGGCTGGAGCACG AAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGC AGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme|Recognition sequence GG/CGCC Nar…
