4. What are things we have to consider when collecting blood using anticoagulated tubes? blood sample should be mixed right after collection pediatric tube can be used if the adult patient vein is difficult to draw the ratio of blood and anticoagulant can be adjusted all of the above

4. What are things we have to consider when collecting blood using anticoagulated tubes? blood sample should be mixed right after collection pediatric tube can be used if the adult patient vein is difficult to draw the ratio of blood and anticoagulant can be adjusted all of the above

Biomedical Instrumentation Systems

1st Edition

ISBN:9781133478294

Author:Chatterjee

Publisher:Chatterjee

Chapter9: Instrumentation In Blood Circulation

Section: Chapter Questions

Problem 2Q

See similar textbooks

Related questions

Q: Is the seedling shown on the right a monocot oreudicot? How can you tell?

A: An embryonic shoot and a root can be found inside a seed. While the cotyledons are linked to the…

Q: Why is a weed significant as a pest?

A: Introduction Pest:- It is defined as a living organism, either an animal, fungus, or plant that is…

Q: Describe the unique way that auxin can move through a plant.

A: Auxins are a type of plant enzyme that resembles morphogens in some ways. Auxins are important for…

Q: Question How does the female reproductive system protect itself from pathogens?

A: Pathogen It is defined as the organism that have the ability to cause a disease. The microbes cause…

Q: Study the diagram below. Put the number of the step in the diagram by its description in the list of…

A: Restriction DNA technology can be defined as a set of techniques ; in which DNA is identified DNA;…

Q: Match the following scientists who emerged in specializedfields of microbiology to their famous…

A: Introduction :- Virology is the study of viruses and virus-like entities, which are submicroscopic…

Q: Question - What is biology? A) The study of DNA. B) The study of the environment. C) The study of…

A: Question - What is biology? A) The study of DNA. B) The study of the environment. C) The study of…

Q: Indicate whether each of the following statements is true (T) or false (F). a. An unsubstantiated…

A: A virus is an infectious microbe consisting of a segment of nucleic acid (either DNA or RNA)…

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: write in one or two sentence for each please. Define the following terms: a. biotechnology:…

A: Introduction Biology:- It is a branch of science that deals with living organisms and their vital…

Q: QUESTION 32 Consider the recombination frequencies data below from a series of two-point crosses…

A: The linkage group has linked genes. These genes stay together during the process of gamete…

Q: You are studying a type of bacteria isolated from the acidic water runoff of a mining operation. You…

A: Introduction Blotting procedures are used to transfer nucleic acids from gels to membranes for…

Q: What are the two body dysfunctions of an animal in the order DECaPODA?

A: decapod order Decapoda any of more than 8000 species of crustaceans phylum Arthropoda that include…

Q: can you please explain the last part of step 2 further? Specifically this "The complementation…

A: Complementation is a relationship between mutations in an organism that helps us determine that the…

Q: How would you devise a screen to identify recessive mutations in Drosophila that result in embryo…

A: Fruit flies, or Drosophila melanogaster, are a good model for studying genetics and were chosen by…

Q: Describe the contributions of the following scientists to thefield of microbiology: Beijerinck,…

Q: All of the following statements about polioviruses are correct except _____. a. Poliovirus…

A: Poliovirus is the causative agent of poliomyelitis, also known as polio. It is a human enterovirus…

Q: Explain auxin’s effect on growth and how it causes plant cellsto enlarge.

A: Plants naturally produce auxins, a potent growth hormone. They promote cell division, stem and root…

Q: 8. If the molecular weight of E. coli DNA is taken as 2.7 x 10° and the average molecular weight of…

A: Nucleic acids are essential for all forms of life and are found in all cells. Nucleic acid comes in…

Q: Describe how the bird populations will most likely change if a severe drought were to occur for a…

A: Bird populations will major change if a severe drought were to occur for a four-year period in…

Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…

A: INTRODUCTION Protein synthesis is the process in which the formation of new proteins takes place. In…

Q: Identify two ways in which the immune responses in gut mucosal tissues contrast with those initiated…

A: Mucosal tissues are found in the body as plasma cells, which are mostly found on epithelial…

Q: Using the data gathered by the instructor from other students in University, calculate the…

A: Given information Free-hanging earlobes (F) is dominant Attached earlobes (f) is recessive Total…

Q: Use a phenomenon to explain how materials (water, glucose, oxygen/carbon dioxide) pass thru the cell…

A: Introduction The movement of materials across cell membranes is known as cell transport. Passive and…

Q: describe the likely pathway a dsRNA takes after being eaten in order for an RNAi effect to be passed…

A: The dsRNA enters the cells as the embryo develops. Through all stages of development this method…

Q: How would you determine the sugar-binding specificity of any isolated lectin?

A: .Lectins are the specialised proteins that may bind to a specific carbohydrates present on the…

Q: What about Phloem?

A: Plants, of course, do not absorb food in the same manner that humans do. Rather, while…

Q: 100 Amo unla tissu 80 capi 60 40 Systemic arterial Po2 Systemic venous 20 Po2 40 60 80 100 1 20 (%)…

A: Hemoglobin is the main protein in the red blood cells. its main function is to carry oxygen to the…

Q: Why is a strong reducing agent, such as NaBH4, not suitable for use in the conjugation of an…

A: The NaBH4 is a strong reducing agent and can reduce aldehyde, ketones and the acid chlorides into…

Q: One objection many people have about vaccinations is the amount and variety of chemicals in them.…

A: Vaccination is a simple, safe and effective way of protecting you against harmful diseases. It uses…

Q: VARIATION IN POPULATION DENSITY OF BEETLES 40 35 30- Species A Species B Species C 25 20- 15 10- 5…

A: Population density: Population density is actually the concentration or total number of a particular…

Q: catalyzes the reaction that creates creatine phosphate in skeletal muscle A Creatine phosphatase…

A: Creatine phosphate is the main high-energy, phosphate-storage molecule of muscle.It is primarily…

Q: 2. The endosperm of maize can either be yellow of White. with two alleles, Y has yellow endosperm…

A: INTRODUCTION The endosperm is the tissue that surrounds and nourishes the embryo in angiosperm seeds…

Q: 5. Define the different system based on the discussion.

A: Introduction The human body is the physical structure of a person. It is made up of a variety of…

Q: Whereas _____ is the predominant immunoglobulin in intestinal fluid, _____ is the dominant…

A: Cell is a simple machine that houses all of the essential organelles required for life's sustenance.…

Q: With regard to the characteristics and replication of HIV discuss reasons why the virus is so…

A: ANSWER) It is very difficult to produce vaccine against the Human immunodeficiency virus as the…

Q: Which statement of the cell theory is connected to an understanding of meiosis? Cells are the basic…

Q: Describe the agar-overlay technique

A: Biological techniques are methods or processes used to study living things. Methods, approaches,…

Q: What are the legal risk of Ethical, Legal and Societal Implications (ELSI) of GMOs

A: Genetically modified organisms are those in which genetic engineering techniques are used to alter…

Q: The muscle cell membrane of the neuromuscular junction is called the A. Synaptic cleft B. Motor end…

A: Introduction The neuromuscular junction (NMJ) is a highly specialised synapse that connects a motor…

Q: bacteria

A: Auxotrophic strains lack the ability to synthesize one essential compound for example amino acid.…

Q: Compare and contrast the action of DNA damaging agents that lead to: 1. Point mutations . 2.…

A: 1. Point mutation... Point mutation is the single nucleotide mutation in DNA. In this mutation…

Q: Distinguish between catabolism and anabolism.

A: Metabolism refers to the chemical events that take place in the cell to produce energy. The acquired…

Q: Describe the probable root system of a crop that has been applied with frequent and light

A: Given: Need to describe the probable root system of crop that must be applied Frequently and in…

Q: onsidering the number of base pairs, compute for the actual length (in micrometers) of this DN

A: There are 7 base pairs. Length of one base pair is 3.4 Angstrom. Length of 7 base pairs is 3.4 X 7=…

Q: Members of Suliformes typically lay 2-3 eggs, but it is rare that more than one nestling survives.…

A: Introduction:- *The Suliformes is a recognised order by the Ornithologist Union. * In light of…

Q: QUESTION 3 Considering the genotypes for the ABO locus and the H-locus of the patient below, what…

A: The ABO blood group is depends on the presence of specific antigen on the plasma membrane of RBC or…

Q: Any change in WT DNA sequence without any phenotypic appearence Mutant Mutation Genotype Phenotype

A: Any change occurs in wild type DNA sequence is called mutation.

Q: potential ways that organisms can respond to rapid changes to their environment, such as can result…

A: Adapting the climate change Adaption is a strategy to survive better and combat with chàllamges in…

Q: The gene ABCD is 1500 bases long. Answer the following questions: What would be the likely…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Concept explainers

Health Assessment

Question

100%

Check all that applies

4. What are things we have to consider when collecting blood
using anticoagulated tubes?
blood sample should be mixed right after collection
pediatric tube can be used if the adult patient vein is difficult to
draw
the ratio of blood and anticoagulant can be adjusted
all of the above

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Answer

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. To ensure quality of blood specimen, which of the following should be considered? ratio of anticoagulant to the volume of blood to be collected clotting time room temperature all of the above 2. In specimen labeling the phlebotomist should indicate in the container patient first name O patient medical record number O date and time of collection O all of the above
1. A phlebotomist would know that s/he has achieved vein access when: A. Blood will automatically pump into the syringe barrel. B. A "flash" of blood will appear in the hub of the needle C. There will be a very slight vibration in the needle D. Blood will immediately flow in the plunger E. You cannot tell when you are in a vein with a syringe. 2. How many times are blood cultures inverted?
2. Which of the following is/are disadvantages of syringe method? (Check all that applies.) Readily available and cheap Time consuming Prone to needle pricks O Easily maneuvered Changeable needle gauge 3. Which of the following is/are included in a properly labeled collection tube? (Check all that applies.) Date and time of collection Name of the patient Age and sex of the patient Name or initials of the phlebotomist Lab test requested 4. Which of the following statements are true about proper disinfection of venipuncture site? (Check all that applies.) Clean site prior to selection of vein Clean site with 70% alcohol for 30 seconds Allow site to dry completely Do not touch the cleansed site before reapplication of tourniquet 5. Post-phlebotomy procedure: (Check all that applies.) Perform hand hygiene Recheck the labels on the tubes Discard used syringe and needle Ask patient how she/he is feeling O O O O O O O O O 0 O O O 0
2. You are preparing to sedate a patient with fentanyl and versed. What supplies and/or medications should you have available at the bedside? 3. You are the nurse in the surgery suite caring for a patient. You look at the anesthesia monitor and see that the patient's blood pressure continues to decline with every 5- minute blood pressure reading, and has been trending this way since anesthesia was started. The anesthesiologist has not said anything to the surgeon, and is adjusting medications, so you continue to monitor your patient and assist with the procedure when necessary. A few minutes later, you notice that your patient's blood pressure has fallen to 56/30, and the anesthesiologist is appearing flustered, but still has not said anything to the surgeon. The surgeon asks you if everything is OK. What do you do?
8. A patient is to be started on an intravenous infusion of heparin for a DVT. The MD orders 50,000 units in 1 liter of NSS. The hospital protocol for heparin bolus is 70 units/kg and the infusion is 14 units/kg/hr. The patient weighs 170lbs. Calculate the bolus dose Calculate the infusion rate in units/hr Calculate the infusion rate in ml/hr.
3. Patient weighs 204lbs. The MD orders heparin to be given to the patient. The patient is to receive a bolus dose of heparin of 72 units/kg. The MD orders 25,000 units of heparin in 500ml D5W. The infusion rate is 16 units/kg/hr. Calculate the bolus dose Calculate the infusion of heparin in units/hr Calculate the infusion rate at ml/hr.
7. A phlebotomist has a requisition to collect an ABG specimen from a patient in the cardiac care unit (CCU). The phlebotomist identifies the patient and records the required requisition information. The patient has an IV in the left arm in the area of the wrist, so the phlebotomist chooses the right arm. The patient is having difficulty breathing and appears quite restless and agitated. The phlebotomist performs the modified Allen test. The result is positive. The phlebotomist attempts puncture of the radial artery. The patient moves his arm as the needle is inserted and it misses the artery. The phlebotomist redirects the needle several times and finally hits the artery. The blood pulses into the syringe but is dark reddish-blue in color. The phlebotomist completes the draw, removes the needle, holds pressure over the site, and at same time activates the needle safety device, removes the needle, and caps the syringe, being careful not to introduce air bubbles into it. After holding…
4. A tourniquet is used by the phlebotomist to assess and determine the location of a suitable vein for venipuncture. Explain briefly:a. Why the tourniquet should be applied prior to blood withdrawal b. Where the tourniquet should be applied before blood can be withdrawn.
13) The cardiac patient is to receive Cardizem 15 mg IVP. The vial contains 10 mg/2 mL. How many mL will you give? 14) The patient is to take Aspirin gr X. The bottle contains Aspirin 650 mg tablets. How many tablets should he take? 129
6. If platelets are ordered before a procedure such as a lumbar puncture or endoscopy to prevent post procedure bleeding, the platelets should be administered: O 1 week before the procedure O 1 day before the procedure O 6 hours before the procedure immediately before the procedure
A patient 12 in. thick is positioned on a table 15 in. from the target of an x-ray tube. The region of interest in the patient is 6 in. in diameter and 3 in. above the table. Can the entire region be displayed at once with an image intensifier with an input screen 9 in. in diameter?
1. A physician orders 500ml of normal saline to infuse over 5 hours. The drop factor is 10gtts/ml. The nurse will regulate the IVF at: _____ 2. A physician orders 1 unit packed RBC to infuse over 4 hours. A unit of blood contains 250ml. The BT set delivers 10gtts/ml. A nurse prepares to set the flow rate at how many drops per minute? 3. Calculate the IV flow rate for 1200 mL of NS to be infused in 6 hours. The infusion set is calibrated for a drop factor of 15 gtts/mL. 4. Mrs. Potter has chronic bronchitis with an infection. To treat the infection, the physician prescribes gatifloxacin (Tequin) 400 mg to infuse in over 2 hours. The pharmacy delivers gatifloxacin 400 mg in a 200-mL bag of NS. What should be the rate of the infusion, in milliliters per hour, to complete the Tequin infusion? 5. The physician prescribes 1,000 mL of D5 NS to infuse at a rate of 200 mL/h. The nurse started the infusion at 5pm. She expects the IVF to be infused completely at what time? 6. Gentamicin sulfate,…