Q: The hydrolysis of ATP requires a. energy. b. water. C. a high temperature. d. energy and water. e.…
A: Answer is.. Water (b)
Q: What are the functions of ovaries in a flowering plant?? A. TO PRODUCE FEMALE GAMETES B. TO PRODUCE…
A: ovary, in flowering plants is enlarged basal portion of the pistil, the female organ of a flower.
Q: Describe how biodiversity contributes to the sustainability of an ecosystem.
A: Biodiversity refers to the variety of life that may be found in a given flora and fauna and even…
Q: Which of the following methods should NOT be used to thaw frozen meats? a) refrigerator thawing b)…
A: Thawing is the process of taking a frozen product from frozen to a temperature (usually above 0°C)…
Q: One of the challenges faced by animals when moving from an aquatic environment to a terrestrial…
A: Name- Dolphin, Phylum it belongs to - Chordata . Adaptations- structural adaptations- they have…
Q: How many amino acids would there be in the protein produced from the following mRNA molecule ?…
A: 1. Stop codons- UAA, UAG and UGA. Codon consists of 3 nucleotides. There are 11 codons, but 10…
Q: In the evolutionary tree, sexual reproduction first appeared in which group of organisms? plants…
A: Answer
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: QUESTION 8 The mating below shows the sex chromosome found in two parents and their resulting…
A: The fragile X mental retardation protein is encoded by FMR1, which is found on the X-chromosome…
Q: European cuckoos and North American brown-headed cowbirds are not close relatives, but both lay…
A: Animal behavior is heavily influenced by the environment to which it belongs. If they do not fit in,…
Q: What is the difference between endergonic andexergonic chemical reactions?
A: A chemical reaction is the transformation of one or more reactants into one or more products.…
Q: QUESTIUN 12 Consider the arrangement of the following four normal chromosomes from some hypothetical…
A: The centromere is involved in an inversion of a chromosomal fragment, and splits happen on both arms…
Q: Scientists discovered a new species of frog and were able to estimate its population at 755…
A: In ecology, we study the interactions that take place between the different organisms and their…
Q: Whereas _____ is the predominant immunoglobulin in intestinal fluid, _____ is the dominant…
A: Cell is a simple machine that houses all of the essential organelles required for life's sustenance.…
Q: bacteria
A: Auxotrophic strains lack the ability to synthesize one essential compound for example amino acid.…
Q: Name and describe the two forms of energy and provide an example of each.
A: According to science , energy is the quantitative attribute that must be transmitted to a body or…
Q: Distinguish between What is known of CD105 (endoglin) as an hepatcellular carcinoma marker and it’s…
A: There are few points that should kept in mind : A molecular or DNA marker is defined as a…
Q: Members of Suliformes typically lay 2-3 eggs, but it is rare that more than one nestling survives.…
A: Introduction:- *The Suliformes is a recognised order by the Ornithologist Union. * In light of…
Q: How can one cell give rise to different types of cells? Support your explanation with embryologic…
A: Introduction A cell is a cytoplasmic mass that is outwardly bound by a cell membrane. Cells are the…
Q: 2. Consider genes that have 2 alleles each. Gene 1 has allele "E" and "e", where E is dominant to e.…
A: A dihybrid test cross is a cross between a double heterozygous individual and a double homozygous…
Q: 5. 5. Draw a phylogeny the following taxa: shark; tuna; frog; lizard; mouse; whale. On your…
A: Evolution solved the challenge by developing the cellular differentiation process, which resulted in…
Q: in certain fish the mating of black-scaled (B) with white a white-scaled (W) will create offspring…
A: Introduction :- Fish are aquatic vertebrate animals having gills but no digits on their limbs, such…
Q: Consider a diploid organism that follows the XX-XO mode of sex determination. Normally, there are 7…
A: Given data, Number of chromosomes present = 7 Chromosome I = large acrocentric chromosome…
Q: In this scenario, we'll be discussing the Xtina gene, which encodes the Xtina protein. Xtina is…
A:
Q: To explain: The defining characteristics of adaptive immunity.
A: Adaptive Immunity: The adaptive immune system, also known as the acquired immune system, is a…
Q: Question - How does the female reproductive system protect itself from pathogens?
A: Female reproductive system is highly protected from pathogen invasion,
Q: 2. Consider the following paragraph from a peer-reviewed publication detailing the extraction and…
A: Lectins These are defined as glycoproteins. They have the ability to make bonds with carbohydrates…
Q: MECHANISMS EXAMPLES 1. 1. Geographical Isolation 3. 1. 2. 2. Temporal/Seasonal Isolation 1. 2. 3.…
A: Temporal isolation is when species that could interbreed do not because the different species breed…
Q: To determine: A defining characteristic of the innate immunity.
A: The ability to remember is the most noticeable feature of the immune system. Memory is an important…
Q: Please discuss the value of international normalized ratio (INR) as a test. Why do you think this is…
A: PT test is the normal blood test conducted to record the time taken for blood to clot.
Q: XBT is a gene that controls the development of the body, specifically by determining the number c…
A: Answer: Toolkit gene These genes regulate the embryonic developments. They are involved in central…
Q: A survey was conducted for a certain trait (the ability to roll tongue or inability to roll the…
A: Introduction Hardy-Weinberg equilibrium:- It states that the genetic variation in a population will…
Q: Describe the proximity in time, similarity in timbre, pitch and good continuation? How are these…
A: Sound is defined as the vibrations that travel through the air or another type of medium as an…
Q: Here is a family pedigree for an imprinting disorder caused by a loss of function mutation in a…
A: A) In the pedigree chart we can see that : Carrier father can pass on the genetic defect to his…
Q: What is carotenoids, carotenes and xanthophyll? Why these compounds are important in human diets?
A: Introduction Photosynthesis is the process through which green plants and other organisms use light…
Q: 1. Name the receptor indicated by the arrow labeled A. 2. What specific layer of the skin is…
A: 1. Meissner's corpuscle They contain a cutaneous nerve ending responsible for transmission of…
Q: a catabolic process.
A:
Q: It has been established that V. parahaemolyticus cross-reacts with many marine bacteria…
A: Serological tests signify those tests, that detect the antibodies against a microorganism. It…
Q: 2. Next, use the Hardy-Weinberg equation (p + 2pg + g = 1) to calculate the expected frequencies of…
A:
Q: is this true or false?
A: Human evolution is defined as "the process by which humans evolved on Earth from now-extinct apes."…
Q: The structure of a lipid bilayer is determined by the particular properties of its lipid molecules.…
A: The plasma membrane's basic structure is a lipid bilayer, which is made up of two leaflets of…
Q: Activity 1: Research 5 similar species with different characteristics. Example: Gartner snakes live…
A: An organism's "niche" is defined by the collection of circumstances, supplies, and relationships…
Q: Multicellular organisms exhibit a hierarchy of cellular organization. The diagram below shows four…
A: On a scale of small to enormous, living beings are highly organized and arranged in a hierarchy. As…
Q: All of the following contribute to the establishment and maintenance of long-lived memory B cells…
A: B cells are lymphocytes which are important for the adaptive immune system's humoral defense…
Q: B. The illustration shows the stages of development in human embryo. 2 CELL EGG 4 CELL EGG…
A: Introduction Life starts from single cell called zygote. Zygote is single diploid cell resulted…
Q: The following graph depicts the relationship between the mean flower depth of Zaluzianskya…
A: Introduction Evolution is the process of a species' features changing over numerous generations…
Q: All of the following are generated directly during the Krebs (TCA) cycle except? a. ATP b. GTP c.…
A:
Q: Calcitonin is enzyme that functions to reduce blood calcium levels
A: Calcium may be a mineral that's found in a very form of foods. calcium is needed by the body to take…
Q: Gestation takes about -____weeks. a) 38-42 b) 44-46 c) 28-30 O d) 48-52
A:
Q: explain two ways in which to lessen or avoid the development of insect resistance to the Cry protein…
A: Introduction Insecticide resistance is a heritable modification in a pest population's…
Summarise in words the information presented in the graph.
Step by step
Solved in 2 steps
- b) Figure 7 shows population growth of Proboscis monkeys over time. 2.0E carrying capacity V 1.5- Monkey populations 1.아- 0.5- Time Figure 7 i) State the type of population growth. ii) Proboscis monkeys nomally live in groups in their natural habitat. What is the dispersion pattern for this monkey population? iii) Describe what happens to Proboscis monkey population at V. 12 iv) Give one (1) possible example of density-dependent factor that affects the Proboscis monkey population.5 x P Parchment Exchange - Leader i earn.edgenuity.com/player/ nce - SC5181 A ņ X 1 2 3 4 5 Mark this and return G how would scientists describe th X How is point intercept used to determine the abundance of a population? OA sample of the population is counted by sight and then extrapolated into a value for the entire population. O A three-dimensional frame is placed next to the target species and is used to tally the number of individuals near it. OA predetermined scale is placed along a transect line and the percent cover of the desired species is measured. O A measured line is laid out in the study area and the number of target individuals underneath it are counted. O M Show is point intercept used to de x B + DELL Save and Exit Next Sign out English Submit Oct 27 K 2:2Population size increases whena. the sum of birth rate and death rate exceeds the sum ofimmigration and emigration.b. the sum of birth rate and immigration exceeds the sum of deathrate and emigration.Figure 37.20 Opportunistic and Equilibrium Species:A Summary.• High reproduction rate• Many ospring• Each ospring receives littleparental care• Low survival rate for juveniles• Early reproductive maturity• Type III survivorship curve:Opportunistic life history Equilibrium life history• Low reproduction rate• Few ospring• Each ospring receivesextensive parental care• High survival rate for juveniles• Late reproductive maturity• Type I survivorship curve:AgeSurvivorsAgeSurvivors764 UNIT SEVEN The Ecology of Lifehoe2420X_ch37_748-765.indd 764 12/15/16 11:45 PMc. the sum of birth rate and emigration exceeds the sum of death rateand immigration.d. the sum of death rate and immigration exceeds the sum of birthrate and emigration.
- - SC5 X P Parchment Exchange - Leader in X G how would scientists describe th x e.learn.edgenuity.com/player/ Science - SC5181 A 1 2 5 How would scientists describe the density of a population? O 47 giraffes living on the African savanna O 194 nematode worms in a given area of soil O 1,500 frogs living in a large pond O6,000 starlings flying in a flock going south Mark this and return how is poirGraph Analysis - Predator-Prey Graph Isle Royale National Park on a remote island was established in 1940, and designated a wilderness area in 1976. The only mode of transportation available is by boat or seaplane. Moose first arrived at Isle Royale around 1900. The moose population tends to increase in years with mild winters, early spring green-up, abundant winter forage, low wolf numbers and low levels of tick infestation. Wolves first arrived at the island on an ice bridge from Canada in 1940. Disease has also influenced the wolf population. Between 1980 and 1982, the wolf population declined from 50 to 14, due to canine parvovirus. Predator Prey on Isle Royale 3000 60 2500 50 2000 40 Number of 1500 30 Moose Number of Wolves 1000 20 500 10 1950 1960 1970 1980 1990 2000 2010 Years Moose WolvesDeer Population on an Island 120 100 96 80 78 60 6아 40 36 20 TO 1 2 3 4 5 6 7 8 9 10 11 12 Number of Months Dear population 1-During which months was the growth of the deer population exponential? | 2-Give one possible reason why the population decreased after 5 months 3-What is the approximate carrying capacity of the island? 4-Explain "carrying capacity" 5-What type of density independent factors may cause the population to decrease (name 2)? 6-What type of density dependent factors may cause the population to decrease (name 2)? 7-Overall, do deer populations seem to exhibit exponential or logistic growth? Explain why Number of Deer
- ← C Sview-source:https://... ezto.mheducation.com/ext/map/index.html?_con=con&external_browser=0&launch Url=https%253A%252F%252Fblackboard.matc.edu%252Fwebapps%252Fblackbo... HW Ch. 2 10 1 points eBook References Mc Graw Hill ODDEBBB Phosphate Deoxyribose sugar H bonds Phosphate G T A H bonds You received partial credit in the previous attempt. Deoxyribose sugar A DNA < Prev Saved U A Deoxyribose sugar M D 10 of 10 top www www W 31 RNA A A Next Backbone R U Ribose sugar Help Save & Exit Submit View previous attempt Feb 26 * 10:13Activity 4. Make a Dichotomous Key. Make a Dichotomous Key for the animals illustrated below https://www.flickr.com/photos/queenslandstatearchives 137884088126 https:pixabay.com/vectors/biodiversity earthworm fertilizer-160380 https:Weommens.wikimedia.arg/aiki/File:CSIRO_Seienoeimage 2186 ARed ackSprderjpg https://en.wikipedia.org/wiki/Tamaraw %3D II IV3806/variants/596276/take/13/ Tp The very long beak of a hummingbird has evolved along with the tubular flower that it pollinates. Which of the following processes explains how these 2 separate populations can change together? All Changes Saved s Answered 56°F Mostly cloudy
- Name: Kathryn Laverty Date: Biology Introduced Species Directions: Write a short response for each of the following scenarios, describing the effect of the invasive species on ecosystem based on the information in the corresponding graphs. In your responses, please use complete sentences with proper grammar and spelling. 1. This graph comes from a study on the effects of European green crabs on the food web in Bodega Bay Harbor, California. 300 Response: 250 Wi 200 0 European Green Crabs Clams Crabs Year 2. The following graphs give information about the populations of Burmese pythons and mammals in the Florida Everglades. 400 SOME ANIMALS ON THE DECLINE IN EVERGLADES NATIONAL PARK 350 Crabs (no./trap) Clams (no./core) European Green Crabs (no./50m²)Change in Rabbit Population 1850-2000 100 90 80 70 60 50 40 30 20 10 white gray white gray 1850 2000 In 1850 there was a large snowshoe rabbit population in Manitoba, Canada. Over the years, the winter coloration (the color of the rabbit's fur) of the surviving rabbit population changed. The graph shows the change in winter coloration of rabbits between 185 to 2000. Based on the data, we could hypothesize that A) the winters are longer in length. B) the snowshoe rabbit has migrated to another area. the amount of snow cover varied over the years. D) more snowshoe rabbit predators have moved into Manitoba. % PopulationMention any four probable reasons for the rapid rise of population in our country?