Match the following scientists who emerged in specializedfields of microbiology to their famous contributions and special-ized field:I. Metchnikoff A. VirologyII. Beijerinck B. ChemotherapyIII. McClintock C. ImmunologyIV. Ehrlich D. Genetics

Match the following scientists who emerged in specializedfields of microbiology to their famous contributions and special-ized field:I. Metchnikoff A. VirologyII. Beijerinck B. ChemotherapyIII. McClintock C. ImmunologyIV. Ehrlich D. Genetics

Comprehensive Medical Assisting: Administrative and Clinical Competencies (MindTap Course List)

6th Edition

ISBN:9781305964792

Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa

Publisher:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa

Chapter30: Assisting With Minor Surgery

Section: Chapter Questions

Problem 1CR

See similar textbooks

Related questions

Q: 1. Female Drosophila with cinnabar eye (cn) and vestigial wings (vg) were mated to males with roof…

A: Test cross is a cross between F1 individual and recessive individual. By crossing the F1 individual…

Q: escribe how the plasmid is cut open by genetic engineers? 2. How is the insulin gene removed from…

A: Since you have ask multiple question, we will solve the first question for you. If you want any…

Q: Describe how ecology affects evolution. Provide an example in which the ecological interaction…

A: Ecology is the inter relationship between the biotic community and abiotic environment. Because it…

Q: treatment for the gentic abnormalitis of calcium metaolism differs depending on the conditon" what…

Q: S-phase arrest in response to glutamine deprivation in KRas-driven cancer cells can be reversed by…

A: The shortage of deoxynucleotides required for DNA synthesis causes KRas-driven cancerous cells to…

Q: O Ferquency O haematuria O oliguria

A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…

Q: Question - Summarize the goals of conservation biology .

A: Conservation biology- It is an applied science based on ecological principles. it focuses on…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: The process of synthesis of proteins from mRNA is called as translation while the process of…

Q: You are studying a type of bacteria isolated from the acidic water runoff of a mining operation. You…

A: INTRODUCTION In chemistry, pH traditionally denoting "ability of hydrogen" is a scale used to…

Q: Fill in the negative homeostatic feedback loop to determine how your body will respond hormonally to…

A: Blood pressure is the blood circulation pressure against the sides of the blood vessels. The bulk of…

Q: It is important for elderly persons to get enough immune systems. to help boost their aging O a)…

A: The vitamins A,D,C and zinc help in building a good immune system and in the better functioning of…

Q: Genotypic Ratio: Phenotypes: Phenotypic Ratio: Rr Genotypes. Genotypic Ratio: Phenotypes: Phenotypic…

A: In order to explain the inheritance pattern Mendel gave three laws -law of dominance, law of…

Q: 21. Which of the following species, either presently or formerly listed as endangered or threatened,…

A: The endangered species are those plants and animals that have become rare as they are at risk for…

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: lain the life cycle (reproduction & development) of ants.

A: Ants are social insects with a social system that divides tasks between the queen and worker ants.…

Q: 1. Male and female animals have a pair of gonads. What advantages does it provide to the species?

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: The O-antigen is part of the bacterium's which is found in the outer membrane of some bacterial cell…

A: Introduction Antigen:- It is any substance that causes the body to make an immune response against…

Q: (Carrying capacity of humans) What is the difference in the carrying capacity of humans with other…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: Which of the following traits would you expect to be under weakest selection? Explain your answer.…

A: Natural selection can be defined as sum of natural forces that causes differntial reproduction and…

Q: 4. In owl, barring (B) is sex-linked and dominant, the recessive allele (b) producing solid black…

A: According to Bartleby guidelines , we are supposed to answer first three subparts in case of…

Q: AC CAG CCC AAG ATT ____________ Transcription: Translation:

A: The flow of genetic information in a biological system is explained by central dogma and it involves…

Q: The enzyme armylase digests.

A: Amylase is an enzyme made up of protein. It is specific with its substrate and its substrate is…

Q: Air sae connection with humerus bone Branchus Humenus bone -Heart 7 Tsil

A: INTRODUCTION The respiratory device is one of the most important structures of the body. It has a…

Q: After Eating a pizza Tomatoes and Pizza Dough =Producers – 10,000 or 20,000 Cheese – Primary…

A: The food chain is the arrangement of organisms in a linear sequence in which the nutrients and…

Q: explain why it is important to maintain sterility when inserting a foley cathether

A: Foley's catheter is an indwelling catheter, i.e. it can be left in place for longer durations than…

Q: The sodium pump is an example of a catabolic process. an anabolic process. stored energy. a. b. C.…

A: The sodium-potassium pump is an example of an active transport membrane protein/transmembrane…

Q: Endosymbiosis states that free-living [ ? ] were engulfed J of and became the [ ]of the eukaryotes…

A: Introduction :- Endosymbiosis occurs when one cell engulfs another, resulting in a coevolved…

Q: To describe: The ecological niche of humans.

A: The intended function that an organism performs within an environment is its niche.The biotic…

Q: Explain how Circulatory Systems works in a: Fish Prawn & Apple snail

A: Every cell, tissue, organ, and organ system in the body is fed by the circulatory system. The…

Q: i INSERTED make an insertion mutation by inserting a C after the 4th codon. Click show protein. Ø…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: how an angiotensin converting enzyme inhibitor ACE such as captopril would effective as an…

A: Anti hypertensive means the drug causes the reduction in blood pressure. Normal blood pressure is…

Q: B. Cholesterol mainly occurs in the cell walls of mammalian cells

Q: The development of DNA technology is bringing profound changes to science, agriculture and…

A: Introduction DNA technology is an extremely important research tool in biology as it allows the…

Q: A group of 3 nucleotides codes for one amino acid. How many codons are needed to make the…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: Question: For bacterial gene transfer via conjugation to occur, the host bacterium must possess a…

A: The conjugation of the bacteria plasmids is called bacterial conjugation and in this here is direct…

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: Transcription Formation of RNA over DNA template is called transcription. Translation The process…

Q: To explain: The way in which the plants with nodules for nitrogen-fixing bacteria might…

A: Nitrogen fixation is the process through which atmospheric nitrogen is converted to ammonia through…

Q: How many moles of EDTA (C10H16N2O3) do you have in 785µl of a 74MM EDTA solution (Mr(C10H16N203) =…

Q: To explain: The way in which predator-prey relationship is affected by natural selection.

A: Charles Darwin was an English naturalist who was interested in outdoor activities from a young age.…

Q: Question - What is biology? A) The study of DNA. B) The study of the environment. C) The study of…

A: Question - What is biology? A) The study of DNA. B) The study of the environment. C) The study of…

Q: 2. Many animals preferentially assist individuals with whom they are most familiar. Explain how such…

A: Introduction Kin refers to someone you are related to a member of one's family.

Q: True or False, genetic drift is a significant mechanism of evolutionary change i populations

A: Changes that a species accumulate over the years lay the foundation of a species through evolution.…

Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…

A: INTRODUCTION Protein synthesis is the process in which the formation of new proteins takes place. In…

Q: PRIMAL PICTURES 1. Name the nervous system receptor labeled A 2. Name the specific structure labeled…

A: The image provided above is an image from the anatomy of the skin. The anatomy of skin shows that…

Q: Question How does the female reproductive system protect itself from pathogens?

A: Pathogen It is defined as the organism that have the ability to cause a disease. The microbes cause…

Q: Describe the function of the key Agrobacterium proteins involved in the transfer and integration of…

Q: Hello, Please answer the following attached Microbiology question AND ANSWER ALL 3 PARTS COMPLETELY.…

A: There are several staining methods are already discovered and continuously used in microbiology one…

Q: Question 5 Describe briefly the TWO distinct roles of the v-SNARE and t-SNARE proteins in vesicle…

A: Role of SNARE proteins in vesicle transport :-

Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

Q: Supported lipid bilayers (SLBs) are widely used in biophysical research to investigate the effect of…

A: Supported lipid bilayer or SLB is the artificial platform based on solid surface, that can mimic the…

Concept explainers

Pre-Darwinian Concepts

Question

Match the following scientists who emerged in specialized
fields of microbiology to their famous contributions and special-
ized field:
I. Metchnikoff A. Virology
II. Beijerinck B. Chemotherapy
III. McClintock C. Immunology
IV. Ehrlich D. Genetics

Study of lifeforms too small to see with the naked eye, including bacteria, viruses and protozoans. Microbiologists may study bacteria, yeast, or other microbes to understand better their reproduction, life cycle, or role in causing disease.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The following are the limitations of Koch's postulates EXCEPT: A. some pathogens cannot grow on artificial media and therefore cannot be identified as the causative agent of the disease B. some diseases involve multiple pathogens which produce similar symptoms making it difficult to pinpoint the causative agent C. some diseases are host-specific and re-inoculation may pose ethical concerns D. some microorganisms are present in the body fluids of the infected animal which make them difficult to be cultured
A. What are the 4 “Koch’s Postulates”? B. Are they still valid today? How would we use them to establish the relationship between a specific microbe and a disease? Can we substitute such things as finding antibodies or DNA traces for some steps? If so, why? C. How has microbiology contributed to the advancement in molecular biology?
The first step for directly linking a microbe to a specific disease according to Koch's postulates is to A.isolate microbes from the blood of healthy animals. B. culture the blood or other body fluid from a diseased animal using nutrient medium. C. inject a sample of blood or other body fluid from a diseased animal into a healthy animal. D. obtain a sample of blood or other body fluid from a diseased animal.
Discuss how antibiotics were developed.
Explain how PCR/OLA (polymerase chain reaction/oligonucleotide ligation assay) can be used in the diagnosis of sickle cell disorder . Would you recommend this method for routine diagnosis of sickle cell disorder? Explain
Which of the following is NOT true about Koch's postulates? First developed by Robert Koch, the pioneering German microbiologist In the first step, the microbe that causes a naturally occurring disease is cultured from a "wild" (non-laboratory) animal which has that disease None of the other four answers (All are true about Koch's Postulates) They represent a process for showing a causal association between a specific microbe and a disease If the same microbe from a diseased "wild" (non-laboratory) host causes the same disease in a lab animal and it can be cultured from that lab animal, this proves that the microbe is the cause of the naturally occurring disease
Which of the following is not associated with gene therapy SCID patients A) utilizes an enzyme to repair the patient’s nonfunctioning ADA gene B) isolation of patient cells C) cloning of functioning a D a gene in bacteria D) use of vector
Name three bacterial species that is contributing to advancing medical therapy and indicate each contribution.
What are three public health measures that could reduce the probability that bacteria will develop resistance to antibiotics? Be specific in your description, and remember to include evidence to support your answer.
In terms of microbial pathogenicity, molecular Koch's postulates are a set of experimental criteria that show: A microbe is the aetiological agent of a disease A gene encodes a product that contributes to disease A gene encodes a product that contributes to immunity to a disease A mutation does not contribute to disease
Discuss the beneficial importance/applications of studying microbiology in terms of a.) causative agents of infectious disease; b.) normal flora; c.)environmental importance; d.) industrial importance; e.) research-genetics
(a) Describe how a microorganism may become resistant to a drug to which it was previously susceptible. (b) What can health care workers do to help prevent the development of drug resistant microbes? (c) What can you do on a personal level to help prevent the development of drug resistant microbes? 2.