Q: Give the major factors that cause changes in the genotype and allele frequencies of a population…
A: Evolutionary mechanisms do not operate in isolation in natural populations. Conservation…
Q: B 1. Name the region of the hair labeled A. 2. Name the structure labeled B. 3. Name the specific…
A: Skin is the outermost protective covering of the body and is the largest organ it is composed of…
Q: Describe the four membranes in the avian egg. How does EACH membrane affect the developing embryo?
A: Avian egg development.
Q: The 2C units of acetyl CoA necessary for fatty acid synthesis in the cytosol comes from the 6C…
A: Fatty acid synthesis It is the process of the formation of fatty acids from 2 carbon molecules…
Q: Can gelatin hydrolysis be correlated with the pathogenicity of a bacterium? Explain your answer
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: If a plant’s stomata are made to stay open at all times, orclosed at all times, it will die. Why?
A: Stomata are the tiny holes which are present on the surface of the leaves. The function of the…
Q: What is a TED talk? TED stands for "Technology Entertainment
A: TED is a global community, welcoming people from every discipline and culture who seek a deeper…
Q: The erythrocyte sedimentation rate (heaviness) testis oftenusedfor a blood sample as a diagnosis of…
A: Erythrocyte sedimentation rate: The erythrocyte sedimentation rate (ESR or sed rate) is the rate at…
Q: Provide an illustration and describe the different types of egg as to the concentration of yolk they…
A: Isolecithal eggs : It is a type of holoblastic egg.. In this type yolk distribution is same that is…
Q: How does RhoGAM prevent HDN? A) it is an antigen that binds to and inactivates anti-Rh antibody from…
A: Introduction Antibody:- It is a protein made by plasma cells (a type of white blood cell) in…
Q: 417 ash Course Biology #7 - ATP & Respiration 1. Cellular respiration is how we derive energy from…
A: Respiration is the biochemical process in which the cells of an organism obtain energy by combining…
Q: Fill in the negative homeostatic feedback loop to determine how your body will respond hormonally to…
A: Blood pressure is the blood circulation pressure against the sides of the blood vessels. The bulk of…
Q: European cuckoos and North American brown-headed cowbirds are not close relatives, but both lay…
A: Animal behavior is heavily influenced by the environment to which it belongs. If they do not fit in,…
Q: Choose which does NOT belong to the group then give the commonality of the remaining 3 terms 1.…
A: In plants; each part have different roles to play for the proper development of plants.
Q: QUESTION 9 For the mating below, indicate whether nondisjunction occurred in the mother, father,…
A: Introduction Genetic analysis refers to the general process of studying and investigating genetics…
Q: Insulin is produced using O Aspergillus OGolden rice O Corn O Safflower
A: Insulin in human is used to lower the blood glucose levels in diabetic patients since they are not…
Q: Indirect bilirubin water insoluble * True O False The ALP are a group of enzymes that hydrolyse in…
A: Bilirubin is found in 2 states ; Direct and Indirect bilirubin. Indirect bilirubin is not conjugated…
Q: Albinism is a rare genetically inherited trait that is only expressed in the phenotype of homozygous…
A: The homozygous recessive genotype (aa) caused albinism in the population. AA and Aa genotypes encode…
Q: Many amino acid biosynthetic operon under attenuation control are also under negative control.…
A: In bacteria, transcriptional attenuation is a common means of regulating gene expression in response…
Q: Direction: With the use of Venn Diagram, compare and contrast the plant and animal reproduction…
A: Van digram use to construct to show difference and similarities between two individuals .
Q: Homologous chromosomes separate at chiasma. O anaphase I O anaphase O anaphase II No answer text…
A: Meiosis is a type of cell division in which total number of chromosome is reduced to half.In this…
Q: Which of these molecules has multiple partial charges and thus is most soluble in water? H H HHHH…
A: Most soluble in water.
Q: Scientists have discovered a new species of bird in Mexico that migrates South to the Amazon…
A: The process of animals migrating over great distances in search of food and shelter, as well as to…
Q: A survey was conducted for a certain trait (the ability to roll tongue or inability to roll the…
A: Introduction Hardy-Weinberg equilibrium:- It states that the genetic variation in a population will…
Q: SEQUENCING: Arrange thes systems of animals. Assign nur your notebook. 10. receptor potentia 11.…
A: Reflex arc Pathway along which nerve impulses travels during the reflex action.
Q: To relate: "The evolution of natural selection and the evolution of features that reduces the…
A: Natural selection is defined as the physical and reproductive fitness of a species in changing…
Q: QUESTIONS FOR RESEARCH AND PROBLEMS 1. Give the major factors that cause changes in the genotype and…
A: The complete set of genetic material in an organism is known as genotype. It can also be referred to…
Q: Discuss the principles and applications of Matrix-Assisted Laser Desorption/Ionization…
A: Technology is utilized in science, while science is used in technology. Both are vital to our…
Q: Imagine that a cell contains a temperature-sensitive mutation such that nuclear lamins cannot be…
A: Mitosis is a process where a single cell divides into two identical daughter cells (cell division).
Q: 1. Name the structure labeled A (there are several in this image). 2. Name the specific tissue that…
A: This is the Histology of the roof of the mouth. This portion is referred to as hard Palate.
Q: Explain in 3 paragraphs Charle’s Darwin Theory of Descent Modification
A: Years and years of Evolution have led to the world that we live in right now. Evolution refers to…
Q: 6. The physiological action(s) of insulin is (are): I. To increase glucose uptake II. To increase…
A: Insulin is a peptide hormone produced by beta cells of the pancreatic islets, and it is regarded as…
Q: What would be the working stock concentration (in molarity) if you diluted 250 uL of a stock…
A: Molarity is defined as the number of moles dissolves in 1000 ml of the solution.
Q: Describe how biodiversity contributes to the sustainability of an ecosystem.
A: Biodiversity improves human health and offers employment in agriculture, fishing, forestry, and many…
Q: 1. THE MALE GAMETES ARE PRODUCED IN THE?? A. TUBULES B. TESTES C. EPITHELIAL D. PENIS 2. PLANT WAS…
A: Spermatogenesis gives rise to the production of male gametes.
Q: In the rumen, unsaturated fatty acids can be converted to saturated fatty acids. True False
A: Fatty acids are the part of lipids. The fatty acids are attached with the glycerol by the ester…
Q: The most likely site for food contamination is: a) a person's own kitchen O b) the grocery store c)…
A: Introduction Food contamination:- It refers to food that has been corrupted with another substance –…
Q: Male spotted bugs often allow the female to eat them during mating. You are a scientist studying…
A: From the graph it can be concluded that the average number of eggs are much more when males are…
Q: Explain in 2-3 paragraphs - Fitness and its relationship with natural selection and adaptation
A: Different organism possess certain traits which may be morphological; physiological which helps them…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A:
Q: In a recent influenza epidemic, physicians were utilizing a rapid diagnostic test to determine which…
A: Influenza It is a viral infection caused by influenza virus. This virus infects the respiratory…
Q: 4. Mr. Salazar has Type A blood while Mrs. Salazar has Type B. They have four children. Bobbie has…
A: Given - Blood type of Mr Salazar - A Blood type of Mrs Salazar - B Therefore, Possible genotypes of…
Q: In this chapter, we have reviewed how the puzzle of trees might be addressed by population,markets,…
A: Introduction Pollution may be defined as the contamination with harmful chemicals, and particles…
Q: Endosymbiosis states that free-living [ ? ] were engulfed J of and became the [ ]of the eukaryotes…
A: Introduction :- Endosymbiosis occurs when one cell engulfs another, resulting in a coevolved…
Q: A group of 3 nucleotides codes for one amino acid. How many codons are needed to make the…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: Give the common characteristics of animals that falls under the category of Family: Felidae in…
A: INTRODUCTION Felidae is a clade of mammals belonging to the order Carnivora and is commonly referred…
Q: The following graph depicts the relationship between the mean flower depth of Zaluzianskya…
A: Introduction Evolution is the process of a species' features changing over numerous generations…
Q: HO HH C-N-C -C- OH R +H20 H H C-N-C N-C OH OH H. R. The chemical reaction illustrated in the…
A:
Q: Describe one function, brought about by the process of meisos, that spermatogenisis and oogenisis…
A: Common function between spermatogenesis, oogenesis and meiosis :-
Q: Give two examples of how forest fragmentation affects animals. How does island biogeography theory…
A: Forest fragmentation is the process by which forests are broken up into smaller and more isolated…
Explain auxin’s effect on growth and how it causes plant cells
to enlarge.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Plant cells communicate in a variety of ways to elicit cellular responses. In the figure below the plant is responding the presence of light with the release of auxin. Auxin was first discovered for its ability to promote growth in plants. It is a plant hormone that inhibits the lengthening and stimulate the formation of lateral roots and root hairs. a) Describe the plant’s response to the presence of light. (refer to picture)Plant cells communicate in a variety of ways to elicit cellular responses. In the figure below the plant is responding the presence of light with the release of auxin. Auxin was first discovered for its ability to promote growth in plants. It is a plant hormone that inhibits the lengthening and stimulate the formation of lateral roots and root hairs. (b) Explain the role that auxin has in eliciting the plant’s response.briefly describe the cell elongation in response to auxin
- Describe in detail each step in a general plant signal transduction pathway.The summer is not optimal for grape growing and you're searching in your memory for something regarding plant hormones. Explain 2 ways you could utilize plant hormones (choose from auxin, ethylene, cytokinin, gibberellin, abscisic acid, salicylic acid, jasonic acid) to compensate for a problem during growing. For each way:Explain the concept of phototropism and how auxin is involve in this process. Give some examples.
