3. Explain the three stages of transcription in Eukaryotic cell. Identify all enzymes used with their corresponding function. Promoter ТАТАAА -30 +1 Transcription start site TEIID TBP +1 Transcription start site TEIIB TEIID TEIIA ТВР +1 Transcription start site TEIE TEIIE TEIIB TEIID TEIIA TEIIH ТВР +1 RNA Polymerase II Transcription start site

Q: Most structural genes of bacteria are grouped together and transcribed from a single affect…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: The DNA sequence within the transcription unit of a gene is shown below. Important sequences are…

A: Transcription is the process which is responsible for making mRNA from the DNA by the action of RNA…

Q: Consider this list (below) of steps involved in transcription. These steps are out of order.…

A: Replication, transcription, and translation are used by all cells to keep track of their genetic…

Q: Which of the following is a property or characteristic of eukaryotic promoters? O They contain the…

A: Promoters in transcription are actually certain specific sequences of DNA that define the starting…

Q: 2. Shown below is the DNA sequence of a eukaryotic gene that encodes a short peptide. The sequence…

A: Introduction :-  The synthesis of m-RNA by using template 3'-5' DNA strand is known as…

Q: 1) RNA polymerase 2) sigma (o) subunit of RNA polymerase 3) rho (p) factor 4) transcription factors…

A: RNA polymerase  extend or polymerise RNA.   Sigma subunit of RNA polymerase binds to promoter…

Q: D D Intron +1 E E A В В C GGGCGG GCCCAATCT TATAAA Intron -5000 -100 -25 1. What region functions…

A: The transcription is the process of conversion DNA to RNA . DNA stands for dioxy ribonucleic acid…

Q: 1.The -glycosidic bond in uridine phosphate exist between a) C1 of ribose and N9 of uracil b) C3 of…

A: 1. The glycosidic linkage involves c-1 of sugar and the hydrogen atom of N-1 in uracil 2 Promoters…

Q: 2. The following schematic shows the chromosomal location of Gene 1 and Gene 2. The corresponding…

A: g)It will not be same. The direction of transcription is always determined by the location of the…

Q: 6)Select ALL of the following that apply to transcription. Select one or more: a. occurs in the…

A: Transcription is that the method by which the information during a strand of deoxyribonucleic acid…

Q: Which of the following is a sequence of DNA where transcription is initiated?   a. Kozak sequence.…

A: Transcription is a heterocatalytic action of an DNA by means of which RNA is synthesized from…

Q: Briefly describe the differences in the transcription and translation processes as they occur in…

A: Asked : Difference in transcription, translation in prokaryotes, eukaryotes

Q: 1.  Gene expression may be regulated after translation using the following mechanisms EXCEPT a. by…

A: Gene expression --Introduction -- Different cell types express different sets of genes . Two…

Q: The following sequence is a mutant version of the above gene that is present in a mutant bacterial…

A: As required, only E and F has been answered.

Q: 5.Below is schematic of gene Z, which encodes for protein Z. the promoter is indicated by the dotted…

A: Given information In the diagram , there are Exon 1, Exon 2 and Exon 3. There are two introns 1 and…

Q: 28) Use this model of a eukaryotic transcript to answer the following questiofn. E = exon and I=…

A: Exons- They are coding sequences present on the primary mRNA transcript as well as the mature mRNA.…

Q: 5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP…

A: Transcription is the process of formation of mRNA from DNA template strands by an enzyme called RNA…

Q: What is a consensus sequence? What are the components of RNA polymerase and what are their functions

A: RNA polymerase is an enzyme that catalyzes the synthesis of RNA from RNA template.

Q: 1. Contents of the diagram below was discovered in the 1960s. Explain in detail what this diagram is…

A: Transcription is defined as the process by which the information present in a strand of DNA will be…

Q: 1. The following regulatory mechanisms occur before eukaryotic transcription EXCEPT a. the…

A: Ans - b. the phosphorylation of eukaryotic initiation factors. Promoters: This is a DNA sequence…

Q: 5

A: The correct answer is A.

Q: in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region…

A: Transcription is the process of formation of transcript that is mRNA from DNA. It is catalysed by…

Q: In transcription, the location where RNA polymerase initially attaches to a gene is called the (a)…

A: Transcription is that the first step of organic phenomenon. Throughout this method, the…

Q: Match the following terms related to transcription in eukaryotes (you may use terms more than once…

A: RNA polymerase (RNAP) is an enzyme that transcribes RNA using DNA as the template. In Eukaryotes…

Q: Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to…

A: Here I will provide you first 10 nucleotides long mRNA sequences according to question.

Q: The diagram below depicts an active transcription bubble after a short period of RNA synthesis…

A: Transcription involves the copying of information from a strand of DNA into a new molecule of…

Q: 3. Shown here is the structure of a human gene. = exons = introns Transcription termination site…

A: According to our guideline we can answer only first 3 subparts of a question. So, upload the…

Q: Given the DNA sequence 5′-AUG GCU AGA GUU GAA  AAA-3′, which of these sequences represents a silent…

A: According to bartleby expert guideline we are allowed to answer only one question. Kindly repost the…

Q: w is the diagram of a eukaryotic gene that encodes a protein. The promoter and n start sites are…

A: Post transcriptional modification removes introns and add existing exons together in the primary RNA…

Q: A bacterial species has a hypothetical sigma  promoter that has the following sequence: TTGGCA ­-…

A: The sequence of nucleotides required for the initiation of transcription is known as the sigma…

Q: Match these transcription-associated terms with the appropriate definition or function. DNA sequence…

A: The transcription of DNA occurs in 3 major steps, initiation, elongation and termination. The…

Q: What is the direction of the growth of newly synthesized RNA chain during transcription?   options:…

A: The first step of gene expression is transcription. A protein subunit or a polypeptide making…

Q: 6. Indicate whether each of the following events occurs when tryptophan is high or when tryptophan…

A: Introduction  Gene Regulation: Expression of gene is highly regulated in both prokaryotes as well as…

Q: 4. Complete this table. Types of mutation: transition, transversion, missense, nonsense, silent CODE…

A: Mutation It refers to the alteration in the sequence of the DNA. It is caused by the mistakes that…

Q: Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is…

A: Given: Sequence of template DNA is…

Q: In negative control systems, which of the following would cause transcription to proceed? A)…

A: Introduction The process of converting a piece of DNA into RNA is known as transcription. Messenger…

Q: . Which of the following repair mechanisms can lead to frameshift mutations? a. Nonhomologous…

A: 1.Answer-- correct option is (b)        Nucleotide excision repair

Q: Mutation #2: • Change the Mutation to RED TACACC IIGGCGACGACT AUGUGG A ACCG CU G CUGA MET -TRP- ASN…

A: Original DNA sequence TAC ACC TTG GCG ACG ACT mRNA sequence           AUG UGG AAC CGC UGC UGAAmino…

Q: 8. The following diagram represents the Christmas-tree-like structures during transcription. On the…

A: Introduction: A single nucleic acid strand has a backbone composed of repeating pentose-phosphate…

Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……

A: Bacterial transcription is the process in which a segment of bacterial DNA is copied into a newly…

Q: Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very…

A: Introduction Transcription : It Is The Initial Stage In Gene Expression, Which Involves "The…

Q: 9. The following sequence is a wild-type bacterial gene that encodes a short protein. The sequence…

A: A) Lower Strand will act as template strand. B)5' ACUUCGAUAUGUCUAAAAUA 3'

Q: Shown is a segment of DNA with its promoter and terminator. Start and end of transcription are…

A: Transcription is the phenomenon in which one stranded RNA is synthesized from DNA strand . But RNA…

Q: 5'.GTCTCTTGACATTG... 3' What is the MRNA sequence transcribed from this sequence (assume the…

A: Ans ) Always Guanine codes for cysteine only .. That is G-C Given.…

Q: 5. How the modification and histone interaction with DNA brought to transcriptional silencing. Use…

A: Yeast Saccharomyces cerevisiae (single-celled fungus microorganisms). Since ancient times, the…

Q: RNA polymerases generally require a primer to begin transcription. (T) (F)   The Death Cap…

A: As per the multiple questions policy, I am attempting the very first question posted by you. Kindly,…

Q: 3. Differentiate between factors and processes involved in transcription: Recognition of this DNA…

A: Transcription is the process by which information in a particular segment of DNA is copied to RNA…

Q: Which of the following statements is true about transcription & translation? O a Ineukaryotes,…

A: According to the Central Dogma of Molecular Biology, DNA generates RNA, which in turn generates…

Q: Using the transcription unit diagrammed below, in which exons are represented by blue boxes and…

A: Transcription is the process of synthesising mRNA from the template strand of DNA.

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.