2. Shown below is the DNA sequence of a eukaryotic gene that encodes a short peptide. The sequence of the final processed mRNA synthesized from this gene is given below. Genomic DNA sequence: 5'-AGCTCATGTGCGAGTCCTGACGCTGACTAGG-3' 3'-TCGAGTACACGCTCAGGACTGCGACTGATCC-5' Processed mRNA sequence: 5'-G*UCAUGUGCGAACGCUGACUAGGAAAAAAAA....-3' In the genomic DNA sequence shown above, draw a box around each of the two exons in the gene or write the two exon sequences. а. b. In the processed mRNA above, some nucleotides are present that are not coded for in the genomic DNA sequence. Name the two processes that have occurred to add these nucleotides to the mRNA.

2. Shown below is the DNA sequence of a eukaryotic gene that encodes a short peptide. The sequence of the final processed mRNA synthesized from this gene is given below. Genomic DNA sequence: 5'-AGCTCATGTGCGAGTCCTGACGCTGACTAGG-3' 3'-TCGAGTACACGCTCAGGACTGCGACTGATCC-5' Processed mRNA sequence: 5'-G*UCAUGUGCGAACGCUGACUAGGAAAAAAAA....-3' In the genomic DNA sequence shown above, draw a box around each of the two exons in the gene or write the two exon sequences. а. b. In the processed mRNA above, some nucleotides are present that are not coded for in the genomic DNA sequence. Name the two processes that have occurred to add these nucleotides to the mRNA.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3' 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGACGACTGCGACGAGCAGC-5' The sequence of the mRNA transcribed from this gene has the following sequence: 5'-AUGAUUCGCCUCGGGGCUCCCCAGUCGCUGGUGCUGCUGACGCUGCUCGUCG-3′ a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.
8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding MRNA 5' 1 3' and translate this mRNA into protein. DNA 3' CGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein UCAGUCAG UCPG Alanine GU U/c GU A Tyrosine C Stop A G Cysteine Valine G A Stop G Tryptophan Arginine A G AC A C UG ACUGACU C Leucine Serine G C A Lysine Proline Asparagine Glycine alanine Leucine Phenyl- Serine Glutamic acid Aspartic acid Histidine Glutamine Threonine
3. Transcribe the following DNA sequences into their corresponding mRNA. (Hint: be sure to pay attention to the 5' and 3' ends!) 3' GGCTTATACGGGCCAAACGTGCATATTGC 5' a) Gene: Matching mRNA 5' 5' TGAACATGGGCAGGTTGACTCGGATCATG 3' b) Gene: Matching mRNA 5' 3' 3'
8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the mRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' CCGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' mRNA 5' Protein Aline Valine Arginine partic Lysine Asparagine COTOCOAQUC. C FOU U G A Glycine Threonine A GUC A GU G Stop Step Cysteine GTryptophan Phenyl- sarine Lauche C Serie CROUCH UG A C U Hatidine Tyrosine 2060 20/ Leucine Proine
17) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80
1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
2. Given a DNA template molecule of 5' - ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence and then the polypeptide sequence, starting at the first start codon. mRNA: 5'- CCAU AUG UUA ACU AGU AGG UAG GAG CCA U - 3' Polypeptide: (N) Met-Leu - Thr - Ser - Arg (C)
2. Consider the pre-mRNA molecule shown below. Re-order the events listed, in the sequence they would occur during pre-mRNA processing in eukaryotes. Pre-MRNA Exon 1 Intron Exon 2 Pre-MRNA processing MRNA Exon1 Exon 2 AAAAA 3 Export to cytoplasm Translation Recognition and binding the 3' AAUAAA sequence by specific proteins Attachment of snRNP U1 to the 5' splice site Formation of a bond between the guanine in the 5' splice site and the adenine of the branch point Binding of the snRNP U4, U5 and U6 complex to the spliceosome Addition of the 5' cap Release of the intron as a lariat structure and splicing of exon 1 and 2 Addition of the poly(A) tail Binding of snRNP U2 to the branch point Cleavage at the poly (A) site
Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letter