) Identify the current stage of the translation process shown in Figure 1 and name the anticodon sequence in tRNA b) State TWO immediate, main consequences when a stop codon reaches the E site.

Q: What is self-splicing intron? Cite two reasons that suggest cukaryotic spliceosomes originated from…

A: RNA (ribonucleic acid) is the complementary strand of DNA (deoxyribonucleic acid) which is…

Q: Aminoacyl-tRNA synthetase joins amino acids to their cognate trna. Briefly discuss the two reactions…

A: Aminoacylation is mechanism of attachment of amino acid to tRNA. Aminoacyl-tRNA synthetase joins…

Q: DNA in human mitochondria encodes 22 different tRNA molecules. However, 32 different tRNA molecules…

A: Mitochondrial gene expression maintain cellular homoeostasis. Mitochondrial gene expression is…

Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…

A: In transcription, mRNA takes the message from DNA to the cytoplasm for translation into proteins…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Some mitochondria use a second codon, in addition to AUG, to specify Met. Which codon(s) is (are)…

A: A codon refers to a specific sequence of deoxy ribonucleotide (DNA) or ribonucleic acid (RNA), which…

Q: Explain post-translational modification of proteins in general with the types of reactions. Provide…

A: Ans:--PMT's are enzymatic , covalent chemical modification of protiens that typically occur ofter…

Q: A shortened version (apo B-48) of apolipoprotein B is formed by the intestine, whereas the…

A: Chylomicrons are a type of lipoprotein particles made up of phospholipids, cholesterol, proteins,…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Define aminoacyl tRNA synthetase

A: Nucleic acids are biological macromolecules that are essential to all known forms of life as they…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…

Q: Transfer RNA molecules are quite large, given that the anticodon consists of only three nucleotides.…

A: Proteins within the human body are made up of a small chain of building blocks, which are termed…

Q: Using threonyl-tRNA synthetase as an example, account for the specificity of threonyl-tRNA…

A: Introduction: Enzymes are the catalysts that increase the rate of the reaction that occurs inside…

Q: 1b) Give the anticodon of the tRNA that would be complementary or a perfect match to the codon…

A: The codon is defined as a sequence of three nucleotide bases on messenger RNA responsible for…

Q: For the tRNA below, determine which amino acid it is charged with. attached amino acid DD GA G 5'…

A: Several biological molecules in animals are tiny and simple, with just one or a few functional…

Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…

A: tRNA possess a set of three nucleotides known as an anticodon. The anticodon of tRNA binds to one or…

Q: 14.18) Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to…

A: It is important to know how DNA and RNA work together to make proteins. In transcription, DNA helps…

Q: What naturally found amino acyl tRNA synthetase can be used to attach 2-aminobutyric acid to a tRNA?…

A: Higher living beings vary in their ability to synthesize the 20 common amino acids. Most bacteria…

Q: The 3 major forms of RNA (mRNA, tRNA, & rRNA) interact during translation. a) Describe the role…

A: Translation is the process of synthesizing a protein from the mRNA. The genetic information in the…

Q: e nucleotide sequence of this anticodon loop under tant tRNA will, a) Recognize GCC as the codon for…

A: tRNA refers to transfer RNA. It helps in decoding an mRNA sequence into a protein. Three nucleotides…

Q: Using the given information, determine the correct order of the following events during translation:

A:

Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…

A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…

Q: a- Name the figure which shows the Co-translational translocation. A or B b -list the molecules…

A: The protein that are destined for secretion, the membrane proteins and the lysosomal proteins are…

Q: Explain what would not occur if aminoacyl-tRNA synthatase was mutated and did not function.

A: tRNA or transfer RNA is the carrier RNA which acts as cargo to pick up the proper anticodons for the…

Q: Give the anticodon of the tRNA that would be a "wobble match" for the codon 5'AGG3'.

A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…

Q: The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the…

A: Shine-delgrano sequence in mRNA is essential for the binding of prokaryotic ribosomes to carry out…

Q: The figure below shows the stage in translation when an incoming aminoacyl-tRNA has bound to the A…

A: Step-2:  The peptidyl transferase is a part of large subunit of ribosome (23S rRNA). It function as…

Q: While helix-turn-helix (HTH) is known to be involved in both eukaryotic and prokaryotic…

A: helix-turn-helix (HTH) is a DNA-binding motif found in a variety of proteins, including…

Q: Describe how the base pairing between the Shine–Dalgarno sequence and the 30S subunit provides a…

A: The translation represents the process of protein synthesis by which the base sequence of the mRNA…

Q: What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?

A: A mutation in the gene that changes its anticodon loop for a tRNA molecule can "suppress" nonsense…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.