2. Oxidation of galactose with conc HNO3 yields a. Galactaric acid b. Glucuronic acid c. Saccharic acid d. Gluconic acid
Q: 1. What is the superhelical density (o) of a closed-circular DNA with a length of 4,200 bp and a…
A: Supercoiling is the coiling of a coil. Now, whether the coil coils in a left-handed direction or…
Q: Fill in the blanks In the given reaction below, the amino acid HỌC NHỚ Coo NH4+ 2 0₂ H₂O₂ HC=0 coo…
A: Amino acids are converted to keto acids inorder to fuel the central process of the cell like…
Q: You've discovered a protein that contains 3 polypeptides, and each subunit is identical in…
A: Proteins are the polymers of amino acids. The individual amino acids in a polypeptide are joined by…
Q: Draw the structure of the pentapeptide "RANCH" and give its systematic name
A: Peptide are chain of amino acids (2 to 50 amino acids). AA are linked by peptide/amide bond by…
Q: What is the physical or structural difference between heterochromatin (also called "heterochromatic…
A: The term "chromatin" describes the DNA and protein combination that makes up the chromosomes present…
Q: 15. A substrate binds to enzyme active site. a) List the roles of serine, histidine and aspartic…
A: The enzyme has serine, histidine and aspartate in the active site. Serine proteases are protein…
Q: Sketch on one reaction rate vs. substrate concentration graph & sketch on one Lineweaver-Burk type…
A: LB plot is double reciprocal plot which gives Km and Vmax values as x intercept and y intercept…
Q: How to draw titration of amino acids ?what happen when ph increase from low to high? 1. what does it…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Bacteriophage T7 encodes its own DNA polymerase, gp5, which has both polymerase activity and…
A: In the given graphs, the polymerase activity and exonuclease activity of DNA polymerase, gp5 is…
Q: How many moles of ATP and GTP will be in use for this polypeptide chain synthesis? What…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: In the corn snake Pantherophis guttatus, there are several different color variants, including…
A: Introns are non-coding sequences and exons are coding sequences in the gene. Splicing is the process…
Q: DNA: Explain the Meselson-Stahl Experiment.
A: The mode of replication in DNA, in which a parental duplex DNA gives rise to two identical daughter…
Q: 384 Hemoglobin: Allostery and Evolution Q5.1 - 2,3-BPG is a negative allosteric regulator of…
A: Hemoglobin (Hb) is a protein that is found in red blood cells. A specific protein called haemoglobin…
Q: Which statements best describe serotonin? Select the correct response(s): It is essential for…
A: Serotonin is a neurotransmitter that is important for inducing sleep, for modulation of memory,…
Q: The octapeptide gly-cys-met-asn-lys-ala-tyr-gly was hydrolyzed consecutively by CNBr and then…
A: The octapeptide gly-cys-met-asn-lys-ala-tyr-gly was hydrolyzed consecutively by CNBr and then…
Q: where in the cell Electron transport chain and oxidative phosphorylation occur?
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: In gluconeogenesis, how is glucose-6-phosphate converted to glucose? is converted to glucose by…
A: Gluconeogenesis is a metabolic process that converts non-carbohydrate carbon substrates such…
Q: One advantage of the protein structures solved by NMR comparing to the x-ray structures is: a. It…
A: Proteins are composed of amino acids attached together via peptide bonds. There are twenty standard…
Q: Please write down the DNA sequence inferred from the below DNA gel. Shown are the products of a…
A: DNA is the genetic material in most living organisms. The information in a DNA molecule is encoded…
Q: If a dialysis tube that is permeable to water but not sucrose contains a 40% sucrose solution that…
A: Water travels across a semi-permeable membrane from the side of the membrane with a lower…
Q: Which of the following is associated with the process of ATP re-synthesis during exercise? a.…
A: During exercise, the muscles are reliant upon the ATP molecules. ATPs provide the energy essential…
Q: What does it mean if a compound is said to have “high phosphoryl transfer potential”?
A: ATP is known as the energy currency of the cell. ATPs are required by the cell for various reactions…
Q: Question 23 of 25 Among the given statements, which ones describe the lysosomes? Select the correct…
A:
Q: of the gluconeogenesis wing is not true? A. Phosphofructokinase-1 (PFK-1) and…
A: Glycolysis - is a process in which one mole of glucose is partially oxidized into two moles of…
Q: Fructose may enter glycolysis via 2 different pathways. Describe the both pathways for fructose to…
A: Fructose is a ketohexose present in honey, fruits, and vegetables. Glucose is the primary and…
Q: At a pH of 10, would you expect this peptide to be retained for a longer time within an anion…
A: Ion exchange chromatography separates molecules based on their charge difference. A cation exchange…
Q: DNA: What is palindromes and secondary structure?
A: Palindromes and secondary structure, both are terms that are related to the structural variation of…
Q: a) A plasmid DNA in bacteria has a length of 14,000 bp and an Lk of 1300. Calculate the superhelical…
A: The linking number of DNA describes the topology of a double-stranded DNA. It is the number of times…
Q: 6. Study the cycle below and answer the following 6.1 Provide a definition for the citric acid cycle…
A: - The Krebs cycle, also known as the TCA cycle (tricarboxylic acid cycle) or the Citric acid cycle,…
Q: Describe the journey of a protein from the ribosome, to the ER, Golgi and then out of the cell.
A: Proteins are distributed in the cytosol, plasma membrane and the organelles like, nucleus,…
Q: (a) Draw the complete linear structure of a small peptide sequence GAKD. (b) At pH=7.0, how many net…
A: Peptides are composed of twenty standard amino acids. The twenty standard amino acids differ from…
Q: A one-to-one protein (P)-ligand (L) complexation (P + L PL) has a equilibrium constant (Kd) value…
A: ∆Cp is the heat capacity at constant pressure. ∆S is change in entropy, degree of randomness. At…
Q: The following are true of the mitochondrial structure I. The inner mitochondrial membrane is…
A: Mitochondria are power house of cell, known to synthesize ATP. They are membrane bound organelles…
Q: You've discovered a novel biosynthetic pathway that makes the molecule caffeine. The pathway can be…
A: In biochemistry, a metabolic pathway is series of enzyme catalysed reaction where product of one…
Q: What charged groups are present in leucine at a pH = 7? OA) 1× NH3¹ B) 1 x COO OC) 1× NH3¹ and 1 ×…
A: Amino acids have a central carbon atom known as α-carbon atom. Each amino acid has an amino group,…
Q: Draw the Gluconeogenesis pathway (pyruvate to glucose) and identify at most 5 different organic…
A: Gluconeogenesis is a metabolic pathway in which glucose is synthesized from certain non-carbohydrate…
Q: The overall process of glycolysis converts a C6 molecule into: O A different C6 molecule O Three C2…
A: Glycolysis is the catabolic pathway and is the first step of cellular respiration that takes place…
Q: if you have a dialysis tube filled with 10 mL of 20% sucrose solution in a beaker with 100 mL of…
A: Osmosis is the movement of water across the semipermeable membrane driven by the difference in…
Q: Differentiate the two monomeric units of starch.
A: Starch has two structural constituents - amylose and amylopectin. Starch is a polysaccharide that…
Q: Algae are being studied as a source of lipids to be used as source of biodiesel as a liquid fuel.…
A: Given that algae uses H2O, NH3, CO2 in the presence of light to produce a compound CH1.8O0.5N0.2 and…
Q: The figure shows an example of a thermal denaturation plot. The melting temperature (Tm) is the…
A: The proteins re folded into their proper three dimensional structure and this folding is driven by…
Q: Amino acid sequence in a protein that can form N-glycosylation is called a glycosylation sequon.…
A: N-linked glycosylation is a post-translational modification process that occurs in the endoplasmic…
Q: A pharmaceutical company developed a drug, CP788, that inhibits the interaction of Grb2 with SH2…
A: Grb2 ( growth factor receptor bound protein 2) is an adaptor protein whose function is to bring…
Q: Briefly describe the role of glycoproteins as antigenic determinants for blood groups.
A: Glycoproteins are proteins with carbohydrates attached to it. The carbohydrates that are commonly…
Q: ĭ HO O-C-R' O=O=O=O -O-C-R" -O-C-R"" A -P=00=0 HII -N-C-R" OH E O-sugar O || -0-C-R" -NH3+ -(CH₂)12…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: The brown discoloration of apples and potatoes is due to an enzyme catalyzed chemical reaction.…
A: Cut apples and potatoes turn brown or discolored on exposure to air. This is due to conversion of a…
Q: Experiment 1.2 - Reaction over time 2. Using the standard curve in 1.1, calculate the amount of…
A: The given graph is representing the relation between the absorbance of Product and the concentration…
Q: Question 15 of 25 Which of the following is true for the acid-base properties of amino acids? Select…
A: The proteins are made of 20 naturally occurring amino acids. The net charge on the side chain of the…
Q: His-Met-Asp-Tyr-Phe-Ser Calculate an approximate pI (isoelectric point) for this peptide. Please use…
A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Give correct answer with explanation
Step by step
Solved in 3 steps
- 1. Arachidonic acidsa. Linoleic polyunsaturated omega-6 fatty acid is its starting materialb. Sphingosine is its structural backbonec. Is the metabolic precursor for the production of most eicosanoidsd. Eicosapentanoic acids is the primary precursor4. Aldosterone is glucocorticoid hormone with Na+/K+ balance in the human body. Cortisol is an adrenocorticoid hormone that also helps in controlling glucose metabolism.a. Neither of the statements are INCORRECTb. Either of the statements are CORRECTc. Both statements are INCORRECTd. Only the First statement is INCORRECTe. Only ONE of the statements in CORRECT4. Which of the following substances is associated with Na+/K+ balance in the human body?a. Cortisolb. Cortisonec. Aldosteroned. Prednisolone5. Which of the following statements concerning steroid hormones is correct?a. Some, but not all of them, are cholesterol derivatives.b. Some, but not all of them, are glucose derivatives.c. Some, but not all of them, are fatty acid derivatives.d.…1. Discuss fully the synthesis of triacylglycerol in the adipose tissue, muscles, intestines and liver. 2. Describe adequately the beta-oxidation of fatty acids. 3. Discuss the synthesis and utilization of ketone bodies.1. Write the reversible reactions with its corresponding enzymes of Dehydration viaHydrolysis reaction. a. Triacylglyceride containing 3 fatty acids such as Oleic, stearic and linoleicacid
- CHOOSE THE CORRECT LETTER. 1. Which of the following molecules is NOT a ketone body?A.B-hydroxybutyrateB.acetoneC. acetyl-CoAD.acetoacetate 2.What intermediate is necessary for glycogenesis to occur?A. UTPB.glucose-1-phosphateC.UDP-glucoseD. UDP1. Discuss why a saturated fatty acid like lauric acid has a good anti-oxidant property. 2. Why are the essential fatty acid associated with low incidence of heart disease? Cite some clinical signs of essential fatty acid deficiency. 3. Explain how aspirin can block the synthesis of prostaglandins?D. The following reactions are encountered in the metabolic cycles. Give the main class of enzymes that catalyzes these reactions. / 10. alanine - propanoic acid + NH, 11. ala-gly-val → ala + gly + val 12. acetylcholine ester choline + acetic acid 13. triglyceride 3 fatty acids + glycerol 14. deoxyribose + bases (A, G, C, T) + P, - DNA 15. glyceraldehyde-3-phosphate dihydroxyacetone phosphate
- 7. List pathways of lipid metabolism activated in adipose tissue after meal. Explain.15. Show the hydrolysis reaction using lipase of a triglyceride containing an omega-3-fatty acid, saturated fatty acid, and omega-6 fatty aid.1. State if true or false a. GLUT5 transporter carries fructose from the intestinal lumen into the enterocyte. b. Microbial enzymes can digest carbohydrates containing β–1,4 bonds
- please show DETAILED mechanism and I will upvote: biotin carboxylase Ö— NH N-carboxyblotin O-C-OH + ATP bicarbonateWhich of the structures below is that of О-а-D-glucopyranosy-(1->1)- а-D-glucoругanoside CH2OH CH2OH O. H H. он H. он H OH ÓH CH2OH HOH2 H. CH2OH CH2OH O. H H. он он H OH он CH2OH H. о, он он H он онKindly answer numbers 4, 5 and 61. The metabolic precursor for the production of most eicosanoids isa. Cholesterolb. Sphingosinec. Arachidonic acidd. Eicosapentanoic acids2. Aspirin reduces inflammation and fever by inhibiting the formation of which of the following types of messenger lipids?a. Prostaglandins; Thromboxanesb. Thromboxanes; Prostaglandinsc. Leukotrienes; Thromboxanesd. Progestins; Prostaglandins3. Which of the following is a correct pairing of concepts?a. Male sex hormones: androgensb. Pregnancy hormones: estrogenc. Female sex hormones: progestinsd. After menopause hormones: estradiol 4. Which of the following substances is associated with Na+/K+ balance in the human body?a. Cortisolb. Cortisonec. Aldosteroned. Prednisolone5. Which of the following statements concerning steroid hormones is correct?a. Some, but not all of them, are cholesterol derivatives.b. Some, but not all of them, are glucose derivatives.c. Some, but not all of them, are fatty acid derivatives.d. All…