
Concept explainers
3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence.
4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA.
5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate.
6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon.
7. Explain how you would determine whether a single chain of
8. Describe all the elements required to carry out the process of translation.
9. Describe the importance of DNA in determining the structure of a particular protein.

Trending nowThis is a popular solution!
Step by stepSolved in 2 steps

- Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid A T G A T C This would be an example of which type of a point mutation?__________________________arrow_forwardA portion of a single strand of DNA is shown below, which contains a amino acid-coding sequence. 5'ACTGCTATGATTGGCTTAGCTGCGTGGACCGTGTCATAGACTGGCT 3' 1. First use this strand as a blueprint to write the Base sequence of a DNA strand that is complementary to this one. 2. Transcribe the complimentary DNA strand that that you made in question 1 into mRNA, and write the mRNA sequence. 3. Finally, use the genetic code dictionary to translate the mRNA that you made in question 2 into the appropriate amino acid sequence.arrow_forwardWrite a short tutorial (short) on how to use the mRNA codon table. In your tutorial explain the importance of the start and stop codons.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





