8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the mRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' CCGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' mRNA 5' Protein Arginine Serine Aspartic Karine Lysine C U G Asparagine A Threonine А GU ט כ AC UG NOROUOTOS, Gerine G U Tyrosine Stop Cysteine Stop Tryptophan Leucine Proline

8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the mRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' CCGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' mRNA 5' Protein Arginine Serine Aspartic Karine Lysine C U G Asparagine A Threonine А GU ט כ AC UG NOROUOTOS, Gerine G U Tyrosine Stop Cysteine Stop Tryptophan Leucine Proline

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding MRNA 5' 1 3' and translate this mRNA into protein. DNA 3' CGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein UCAGUCAG UCPG Alanine GU U/c GU A Tyrosine C Stop A G Cysteine Valine G A Stop G Tryptophan Arginine A G AC A C UG ACUGACU C Leucine Serine G C A Lysine Proline Asparagine Glycine alanine Leucine Phenyl- Serine Glutamic acid Aspartic acid Histidine Glutamine Threonine
5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of each
Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
DNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding strand Write down the sequence of nucleotides in a fragment of an m-RNA molecule that will be produced based on the information in the DNA fragment above (start with 5' and end with 3'). If you separate codons in MRNA with blank spaces, it will be easier to do the next step. MRNA: 5' Using a three-letter code for amino acids write the sequence of the first ten amino acids of the protein pectate lyase (refer to the table of 64 codons from a lecture or a textbook).
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.