Describe and explain the 3-D structural change to the protein (uniprotkb-p39086/gene regulator 5) upon initial binding.

Consider the mechanism of the enzyme RNase:   What would happen to the Km (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a lysine? Explain.   What would happen to the Kcat (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a valine? Explain.

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.

70Pre-initiation begins with either TFIIF or TATA binding protein binding to the core promoter. Yesorno 71Exons tend to be non-conserved during evolution, whereas introns usually are conserved. Yesorno 72Transfer RNA molecules fold into L-shaped three-dimensional structures. Yesorno

IIVY is a LysR regulator, and it helps control transcription of a neighboring gene, ilvC. IlvY can either bend the DNA and block RNAP's access to ilvC's -35 promoter site, or it can allow access to the ilvC -35 site, thereby promoting ilvC transcription. What determines whether llvY is repressing or activating transcription from the ilvC promoter? The presence of the co-inducer acetolactate - acetolactate binds to llvY and changes llvY's shape such that it doesn't block the -35 of the ilvC promoter. IlvY represses ilvC transcription when the IlvC protein is bound to llvY, and it activates ilvC transcription when the lvC protein is not present to bind to llvY. The presence of the co-inducer valine - when valine is present, it binds llvY and causes llvY to repress transcription from the ilvC promoter. The presence of the co-inducer acetolactate - acetolactate induces negative supercoiling at the ilvC promoter, which represses ilvC transcription.

Explain how the miR-200 family of miRNAs behave as tumorsuppressorgenes. What happens when their expression is blocked or decreased?

RNA knockdown has become a powerful tool in the arsenal of methods used to repress gene expression. Briefly describe how gene expression can be knocked down. What effect would introducing siRNAs to TSC1 have on human cells?

Q