A fish inherits a mutation in the Pitx1 coding region. This is a nonsense mutation that introduces a premature stop codon, resulting in a nonfunctional truncated protein. You isolate DNA from jaw, pelvic, eye, and pituitary tissues..... ་་་་་་་་kMk Jaw Eye Pelvis Activator 1 Pituitary Jaw switch switch Pelvic switch Pitx1 ብብ ብብብብ Pituitary Activator 3 Pituitary switch Jaw switch Pelvic switch Pitx1 Activator 2 Pituitary Jaw switch switch Pelvic switch Pitx1 ብብብብብብ Activator 4 Pituitary Jaw Pelvic switch switch switch Pitx1 8. Where would you expect Pitx1 to be expressed in the above scenario? ☐ jaw ☐ pelvis eye Pituitary

A fish inherits a mutation in the Pitx1 coding region. This is a nonsense mutation that introduces a premature stop codon, resulting in a nonfunctional truncated protein. You isolate DNA from jaw, pelvic, eye, and pituitary tissues..... ་་་་་་་་kMk Jaw Eye Pelvis Activator 1 Pituitary Jaw switch switch Pelvic switch Pitx1 ብብ ብብብብ Pituitary Activator 3 Pituitary switch Jaw switch Pelvic switch Pitx1 Activator 2 Pituitary Jaw switch switch Pelvic switch Pitx1 ብብብብብብ Activator 4 Pituitary Jaw Pelvic switch switch switch Pitx1 8. Where would you expect Pitx1 to be expressed in the above scenario? ☐ jaw ☐ pelvis eye Pituitary

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Mutation in the fibroblast growth factor receptor (FGFR) gene results in achondroplasia (dwarfism), which is a dominant condition caused by a single base substitution (GGG>AGG) that changes the amino acid glycine at position 480 to arginine (G480R) in the FGFR protein. Normally, FGFR is active when FGF binds to it and inhibits excessive bone growth, but the mutant FGFR is constantly active even when FGF is not bound to it. o How can you create a mouse model for achondroplasia? Select all that apply. OPronuclear injection of a mutant copy (G48OR) of the gene to a mouse zygote V CRISPR that knocks in a mutant copy (G480R) of the gene to a mouse genome O CRISPR that knocks out the wild-type gene in a mouse genome O RNAI that knocks down the wild-type gene expression in a mouse genome O FGFR gene inactivated by a marker gene is introduced to embryonic stem cells
The melatonin receptor exists in different isoforms: MT1, encoded by MT-1 gene and MT2, encoded by MT-2 gene. The following is the sequence corresponding to 90-140 base pairs (bp) of MT-1 and MT-2 genes. Which of the following statements are true for these DNA sequences. Select all that apply. 90 140 MT-1: 5'------GATATGCCCCCCCCGGCGCGCGATATGCCCCCCCCGGCGCGCGTGCGTGA -3' 3'------CTATACGGGGGGGGCCGCGCGCTATACGGGGGGGGCCGCGCGCACGCACT- -5' 90 140 ---GATATGATATATATATATATAGATATGAAAAATTTTTATATAGTGCGTGA- MT-2: 5' ---3' 3'-----CTATACTATATATATATATATCTATACTTTTTAAAAAATTATCACGCACT-- ----5' MT-2 will denature at a higher temperature than MT-1 1 MT-2 will denature at a lower temperature than MT-1 MT-1 will denature at a higher temperature than MT-2 MT-1 will denature at a lower temperature than MT-2
Munchkin cats have a mutation in the fibroblast growth factor receptor (FGFR3) gene, the same gene mutated in humans suffering from achondroplasia. In cats and humans this causes dwarfism because FGFR3 has a negative effect on bone growth. In achondroplasia, the mutated form of the FGFR3 receptor is constitutively active and this leads to severely shortened bones. A) Draw a simple diagram of the FGFR effect on bone growth in "normal" cats. B) Crossing two munchkin cats always yields 2 munchkin kittens for every 1 normal kitten. True breeding munchkin cats do not exist. Explain this result by showing the genotypes of all parents and offspring. Define the alleles (indicate which is dominant and which is recessive).
A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’ what type of mutation is this? Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?
Munchkin cats have a mutation in the fibroblast growth factor receptor (FGFR3) gene, the same gene mutated in humans suffering from achondroplasia. In cats and humans this causes dwarfism because FGFR3 has a negative effect on bone growth. In achondroplasia, the mutated form of the FGFR3 receptor is constitutively active and this leads to severely shortened bones. A) Draw a simple diagram of the FGFR effect on bone growth in "normal" cats. B) Crossing two munchkin cats always yields 2 munchkin kittens for every 1 normal kitten. True breeding munchkin cats do not exist. Explain this result by showing the genotypes of all parents and offspring. Remember to define your alleles and indicate which is dominant and which is recessive.
For each of the following situations, provide a plausible explanation for how it could lead to unrestricted cell division.(a) Colon cancer cells often contain mutations in the gene encoding the prostaglandin E2 receptor. PGE2 is a growth factor required for the division of cells in the gastrointestinal tract.(b) Kaposi sarcoma, a common tumor in people with untreated AIDS, is caused by a virus carrying a gene for a protein similar to the chemokine receptors CXCR1 and CXCR2. Chemokines are cell-specific growth factors.(c) Adenovirus, a tumor virus, carries a gene for the protein E1A, which binds to the retinoblastoma protein, pRb. (d) An important feature of many oncogenes and tumor suppressor genes is their celltype specificity. For example, mutations in the PGE2 receptor are not typically found in lung tumors. Explain this observation. (Note that PGE2 acts through a GPCR in the plasma membrane.)
What is the purpose of having a sex hormone binding protein within the blood stream? What is the purpose of having a specific receptor for estrogen within the cell? The estrogen receptor binding domain has many known mutations that effect estrogen binding and result in breast cancer. One particular mutation found at aspartic acid is changed to glycine in cancer patients. Draw a potential interaction with the side chain of this aspartic acid with estrogen (name and label it) and how a mutation to glycine could affect this ability to efficiently bind to estrogen. 6.
Marfan syndrome is due to a mutation in a gene that encodes aprotein called fibrillin-1. It is inherited as a dominant trait. Thefibrillin-1 protein is the main constituent of extracellular microfibrils.These microfibrils can exist as individual fibers or associatewith a protein called elastin to form elastic fibers. People with thedisorder tend to be unusually tall with long limbs, and they mayhave defects in their heart valves and aorta. Let’s suppose aphenotypically unaffected woman has a child with a man whohas Marfan syndrome.A. What is the probability this child will have the disease?B. If this couple has three children, what is the probability thatnone of them will have Marfan syndrome?
You wish to find the cis-acting regulatory DNA elements responsible for the transcriptional responses of two genes, c-fos and globin. Transcription of the c-fos gene is activated in response to fibroblast growth factor (FGF), but it is inhibited by cortisol (Cort). On the other hand, transcription of the globin gene is not affected by either FGF or cortisol, but it is stimulated by the hormone erythropoietin (EP). To find the cis-acting regulatory DNA elements responsible for these transcriptional responses, you use the following clones of the c-fos and globin genes, as well as two “hybrid” combinations (fusion genes), as shown in the diagram below. The letter A represents the intact c-fos gene, D represents the intact globin gene, and B and C represent the c-fos–globin gene fusions. The c-fos and globin exons (E) and introns (I) are numbered. For example, E3(f) is the third exon of the c-fos gene and I2(g) is the second intron of the globin gene. (These labels are provided to help you…
"In most differentiated tissues, daughter cells retain a memory of gene expression patterns that were present in the parent cell through mechanisms that do not involve changes in the sequence of their genomic DNA" is true or false.
Alpha-1 antitrypsin has codominant inheritance. M genes express normal levels. S and Z genes have low expression. Which of the following is most likely to develop emphyema? A person with: 1) two M genes who does smoke 2) two S genes who does smoke 3) one M and one S gene who does not smoke 4) one M gene and one S gene who does smoke 5) two M genes who does not smoke 6) two S genes who does not smoke
a. When gene probes, fi ngerprinting, and sequencing make it possible for you to know about genetic diseases in you or one of your children, would you wish to use this technology to fi nd out? b. What if it were used as a screen for employment or insurance? c. Most of us would agree to growth hormone therapy for a child with dwarfi sm, but how do we deal with parents who want to give growth hormones to their 8-year-old son so that he will be “better at sports”?