The melatonin receptor exists in different isoforms: MT1, encoded by MT-1 gene and MT2, encoded by MT-2gene.The following is the sequence corresponding to 90-140 base pairs (bp) of MT-1 and MT-2 genes.Which of the following statements are true for these DNA sequences. Select all that apply.90140MT-1: 5'------GATATGCCCCCCCCGGCGCGCGATATGCCCCCCCCGGCGCGCGTGCGTGA-3'3'------CTATACGGGGGGGGCCGCGCGCTATACGGGGGGGGCCGCGCGCACGCACT--5'90140---GATATGATATATATATATATAGATATGAAAAATTTTTATATAGTGCGTGA-MT-2: 5'---3'3'-----CTATACTATATATATATATATCTATACTTTTTAAAAAATTATCACGCACT------5'MT-2 will denature at a higher temperature than MT-11 MT-2 will denature at a lower temperature than MT-1MT-1 will denature at a higher temperature than MT-2MT-1 will denature at a lower temperature than MT-2

The DNA is a double stranded nucleic acid that contain 4 types of nitrogenous bases that are adenine…

The melatonin receptor exists in different isoforms: MT1, encoded by MT-1 gene and MT2, encoded by MT-2 gene. The following is the sequence corresponding to 90-140 base pairs (bp) of MT-1 and MT-2 genes. Which of the following statements are true for these DNA sequences. Select all that apply. 90 140 MT-1: 5'------GATATGCCCCCCCCGGCGCGCGATATGCCCCCCCCGGCGCGCGTGCGTGA-------3' -5' 3'------CTATACGGGGGGGGCCGCGCGCTATACGGGGGGGGCCGCGCGCACGCACT- 90 140 MT-2: 5' . - - - GATATGATAΤΑΤΑΤΑΤΑΤΑΤAGATATGAΑΑAATTTTTΑΤΑΤAGTGCGTGA- 3' 3'------СТАТАСТАТАТАТАТАТАТАТСТАТАСТТТTTAAAAAATТАТСАСGCAСТ- 5' MT-2 will denature at a higher temperature than MT-1 1MT-2 will denature at a lower temperature than MT-1 MT-1 will denature at a higher temperature than MT-2 MT-1 will denature at a lower temperature than MT-2

The melatonin receptor exists in different isoforms: MT1, encoded by MT-1 gene and MT2, encoded by MT-2 gene. The following is the sequence corresponding to 90-140 base pairs (bp) of MT-1 and MT-2 genes. Which of the following statements are true for these DNA sequences. Select all that apply. 90 140 MT-1: 5'------GATATGCCCCCCCCGGCGCGCGATATGCCCCCCCCGGCGCGCGTGCGTGA-------3' -5' 3'------CTATACGGGGGGGGCCGCGCGCTATACGGGGGGGGCCGCGCGCACGCACT- 90 140 MT-2: 5' . - - - GATATGATAΤΑΤΑΤΑΤΑΤΑΤAGATATGAΑΑAATTTTTΑΤΑΤAGTGCGTGA- 3' 3'------СТАТАСТАТАТАТАТАТАТАТСТАТАСТТТTTAAAAAATТАТСАСGCAСТ- 5' MT-2 will denature at a higher temperature than MT-1 1MT-2 will denature at a lower temperature than MT-1 MT-1 will denature at a higher temperature than MT-2 MT-1 will denature at a lower temperature than MT-2

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

When the amino acid sequences of insulin isolated from different organisms were determined, differences were noted. For example, alanine was substituted for threonine, serine for glycine, and valine for isoleucine at corresponding positions in the protein. List the single-base changes that could occur in codons of the genetic code to produce these amino acid changes.
An experiment was conducted with two groups of genetically identical female agouti mice (Avy/a) that were mated with normal (a/a) male mice . Both female groups ate lab chow with bisphenol A (BPA) (50mg/Kg). (BPA, used in the manufacture of polycarbonate plastics, has estrogenic effects that include decreased CpG methylation.) The lab chow of one group was supplemented with methyl donors (e.g., folate, choline, and vitamin B12). The effects of BPA were abolished in the Avya offspring of the mice fed with the methyl donor–supplemented chow (i.e., the coat color distribution observed was shifted toward brown). Explain.
Determine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG AUU CUG GAA AUU ACC UCC AUC AUG AAG CGC UGA CCC AUU AUU AA - 3'
A portion of the sequence from the DNA coding strand of the chick ovalbumin gene is shown. Determine the partial amino acid sequence of the encoded protein. CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA Enter the 3-letter abbreviation for each amino acid in sequence, separated with dashes, and no spaces (example: xxx-xxx-XXX-XXX...) The amino acid sequence is .1104bp..…........
Several genes code for enzymes that are responsible for histidine biosynthesis in Escherichia coli. Part of the nucleotide sequence of the gene that codes for one of these enzymes is: AUG CCU UGG GCC CAA AAA UGC A series of mutants that have lost activity for this enzyme are recovered. The mutant products are analyzed and found to have the following amino acid sequences: Mutant 1: Met-Pro-Trp-Pro-Glu-Lys-Cys Mutant 2: Met-Pro Mutant 3: Met-Pro-Cys-Gly-Pro-Lys-Met Mutant 4: Met-Pro-Trp-Pro-Lys-Asp Choose the correct type of mutation that occurred in the DNA to produce each mutant type. Nonsense Answer Missense Answer Addition Answer Deletion Answer
The tumor suppressor pRB also binds to and suppresses theactivity of retinoblastoma binding protein 2 (RBP2), ahistone demethylase that removes methyl groups from diand trimethylated lysines in histone 3. What is the possibleconsequence of an inactivating mutation in RB1 that causesan inability of pRB to bind RBP2?
The tumor suppressor pRB also binds to and suppresses the activity of retinoblastoma-binding protein 2 (RBP2), a histone demethylase that removes methyl groups from di- and trimethylated lysines in histone 3. What is the possible consequence of an inactivating mutation in RB1 that causes an inability of pRB to bind RBP2?
The proximal histidine residues have been replaced by glycine residues by mutation of the cloned genes for both the α and β subunits of hemoglobin. With the tetrameric mutant hemoglobin (all subunits being mutant, α H F8 G, β H F8 G), it was found that the “proximal” coordination bonds to hemes in the mutant protein could be replaced by having the small molecule imidazole in the buffers. Oxygen binding curves for the tetrameric mutant hemoglobin were measured. A. The degree of cooperativity in oxygen binding for the mutant hemoglobin (with imidazole present) would be expected to 1) increase 2) decrease 3) not be affected) compared with the normal protein. B. Justify your answer to part A in terms of what you know about the structural basis of cooperativity in hemoglobin. C. How would the Hill coefficient for the mutant be expected to change compared with nH for normal hemoglobin, which is ~3?
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)
Insulin is a peptide hormone encoded by the INS gene, which is on chromosome 11. Insulin is produced by pancreatic beta cells. A) Both the INS gene and insulin are examples of biological molecules that are polymers. What are the monomers and what is the polymer that make up the INS gene? What is the name of the monomers and polymer that make up insulin? B). How many copies of the INS gene are found in pancreatic beta cells? How many copies are found in other cell types, for example, cardiac muscle cells? C). Is mRNA for insulin produced in equal amounts in pancreatic beta cells and cardiac muscle cells? Why or why not? D) Diabetes mellitus can be caused by a dominant mutation in the INS gene, INS*C96Y. A healthy mother has an affect child. Give the genotype of the child at the INS locus, indicating the paternally and maternally inherited alleles.
Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus to the carboxyl-terminus. Are the following questions about lactose permease true or false? A. Because the 64th amino acid is glycine and the 68th amino acid is aspartic acid, the codon for glycine, 64, is closer to the 3′ end of the mRNA than the codon for aspartic acid, 68. B. The mRNA that encodes lactose permease must be greater than 1241 nucleotides in length.