Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 22QP
Make the complementary strand for the following DNA template and label both strands as 5′ to 3′ or 3′ to 5′ (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA?
template: P—AGGCTCG—OH
new strand:
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3’ to 5’ (hint: determine first if P = phosphate or –OH are the 5’ or 3’ end of the strand). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA?
Template : P- AGGCTCG-OH
New strand :
Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3’ to 5’ (hint: determine first if P = phosphate or –OH are the 5’ or 3’ end of the strand). Draw an arrow showing the direction of synthesis of the new strand. How many total hydrogen bonds are in this double strand of DNA?
Template : P- AGACTTG-OH
New strand :
Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3’ to 5’ (hint: determine first if P = phosphate or –OH are the 5’ or 3’ end of the strand). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA?
Template : P- AGACTTG-OH
New strand :
Chapter 8 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 8.4 - Two genes associated with breast cancer, BRCA1 and...Ch. 8.4 - Prob. 2GRCh. 8 - What are Bruces options at this point? Bruce and...Ch. 8 - Should he reconsider and try chemotherapy instead?...Ch. 8 - Should he go ahead and enroll on the chance that...Ch. 8 - Until 1944, which cellular component was thought...Ch. 8 - Why do you think nucleic acids were originally not...Ch. 8 - Prob. 3QPCh. 8 - In the experiments of Aery, MacLeod, and McCarty,...Ch. 8 - Read the following experiment and interpret the...
Ch. 8 - Recently, scientists discovered that a rare...Ch. 8 - List the pyrimidine bases, the purine bases, and...Ch. 8 - In analyzing the base composition of a DNA sample,...Ch. 8 - The basic building blocks of nucleic acids are: a....Ch. 8 - Adenine is a: a. nucleoside b. purine c....Ch. 8 - Polynucleotide chains have a 5 and a 3 end. Which...Ch. 8 - DNA contains many hydrogen bonds. Are hydrogen...Ch. 8 - Prob. 13QPCh. 8 - State the properties of the WatsonCrick model of...Ch. 8 - Using Figures 8.7 and 8.9 as a guide, draw a...Ch. 8 - A beginning genetics student is attempting to...Ch. 8 - Chemical analysis shows that a nucleic acid sample...Ch. 8 - Prob. 18QPCh. 8 - RNA is ribonucleic acid, and DNA is...Ch. 8 - What is the function of DNA polymerase? a. It...Ch. 8 - Which of the following statements is not true...Ch. 8 - Make the complementary strand for the following...Ch. 8 - How does DNA replication occur in a precise manner...Ch. 8 - Nucleosomes are complexes of: a. RNA and DNA b....Ch. 8 - Discuss the levels of chromosomal organization...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?arrow_forwardDraw a stylized diagram of double-stranded DNA. Use a pentagon for sugar, a circle for phosphate and a square for bases. Label each base A, T, C or G. Show two pairs of nucleotides connected via hydrogen bonds (use all 4 letters). Show the polarity of each strand and clearly indicate the number of hydrogen bonds in each pair of nucleotides. Draw a solid-line circle around a nucleotide. Draw a dashed-line circle around a nucleoside. Indicate a phosphodiester bond using an arrow.arrow_forwardFor the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandarrow_forward
- Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’arrow_forwardList the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-Garrow_forwardA DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Lengtharrow_forward
- Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences: 5'CGGAC3'arrow_forwardConsider the following DNA sequence: -T -- -- If RNA primase used this section of DNA to make a primer, what would be the correct sequence of base pairs (from top to bottom)? T-A-C-C-G-T-T OT-U-C-C-G-U-U OA-T-G-G-C-A-A U-A-C-C-G-U-Uarrow_forwardWrite the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'arrow_forward
- What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.arrow_forwardDNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence 5’-CCG ATC GCA CAA-3’ Using this sequence as template after transcription no protein can be translated. Why? Presence of start codon Absence of start codon Due to mutation If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)? Substitution of C with G No change4 Deletion of Both I & IIIarrow_forwardGiven the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY