Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 15QP
Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds.
FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5′ to 3′, and the right strand runs 3′ to 5′. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand.
FIGURE 8.7
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Write out the DNA sequence using the following instructions:
This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing
Each strand contains ten nucleotides
Each strand contains all four different types of nucleotides
You should indicate clearly the directionality of each strand in your answer
You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotide
draw a strand of DNA 4 nucleotides long (4 nucleotides on each side). Label the 5’ ends, the 3’ ends, the bond that holds the DNA backbone together, the glycosyl bond, and the bond that holds the nitrogenous bases together. You can use “P” to represent phosphate, and ATCG to represent the nitrogenous bases. Please try to draw the sugar accurately and include any unbonded functional groups, including the oxygen within the molecule.
The DNA sequence you use will be the following: T - A - G - C - C - A. You will need to make the complementary strand - fill in the table below with the complementary base pairs (remember Chargaff’s rule: A = T and C = G)
5’
T
A
G
C
C
A
3’
3’
5’
Chapter 8 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 8.4 - Two genes associated with breast cancer, BRCA1 and...Ch. 8.4 - Prob. 2GRCh. 8 - What are Bruces options at this point? Bruce and...Ch. 8 - Should he reconsider and try chemotherapy instead?...Ch. 8 - Should he go ahead and enroll on the chance that...Ch. 8 - Until 1944, which cellular component was thought...Ch. 8 - Why do you think nucleic acids were originally not...Ch. 8 - Prob. 3QPCh. 8 - In the experiments of Aery, MacLeod, and McCarty,...Ch. 8 - Read the following experiment and interpret the...
Ch. 8 - Recently, scientists discovered that a rare...Ch. 8 - List the pyrimidine bases, the purine bases, and...Ch. 8 - In analyzing the base composition of a DNA sample,...Ch. 8 - The basic building blocks of nucleic acids are: a....Ch. 8 - Adenine is a: a. nucleoside b. purine c....Ch. 8 - Polynucleotide chains have a 5 and a 3 end. Which...Ch. 8 - DNA contains many hydrogen bonds. Are hydrogen...Ch. 8 - Prob. 13QPCh. 8 - State the properties of the WatsonCrick model of...Ch. 8 - Using Figures 8.7 and 8.9 as a guide, draw a...Ch. 8 - A beginning genetics student is attempting to...Ch. 8 - Chemical analysis shows that a nucleic acid sample...Ch. 8 - Prob. 18QPCh. 8 - RNA is ribonucleic acid, and DNA is...Ch. 8 - What is the function of DNA polymerase? a. It...Ch. 8 - Which of the following statements is not true...Ch. 8 - Make the complementary strand for the following...Ch. 8 - How does DNA replication occur in a precise manner...Ch. 8 - Nucleosomes are complexes of: a. RNA and DNA b....Ch. 8 - Discuss the levels of chromosomal organization...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How many kilobases of the DNA strand below will code for the protein product?arrow_forwardDraw the chemical structure of a dinucleotide composed of A and G. Opposite this structure, draw the dinucleotide composed of T and C in an antiparallel (or upside-down) fashion. Form the possible hydrogen bonds.arrow_forwardFor the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandarrow_forward
- The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?arrow_forwardDraw a stylized diagram of double-stranded DNA. Use a pentagon for sugar, a circle for phosphate and a square for bases. Label each base A, T, C or G. Show two pairs of nucleotides connected via hydrogen bonds (use all 4 letters). Show the polarity of each strand and clearly indicate the number of hydrogen bonds in each pair of nucleotides. Draw a solid-line circle around a nucleotide. Draw a dashed-line circle around a nucleoside. Indicate a phosphodiester bond using an arrow.arrow_forwardIn the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:arrow_forward
- 1) You will start off by laying out your individual nucleotides for the first strand using the following sequence: A, C, G, T. 2. Using a pem or pemcil, indicate the phosphodiester bond that forms between each of the nucleotides. Look at figure 7 Label the 5' and 3' ends of the strand you just built. Identify and label one purine and one pyrimidine nitrogen base. 2. You are now ready to build your second strand. The second strand will be antiparallel. You will need to flip the nucleotides upside down to form hydrogen bonds between the nitrogen bases. Remember, A bonds to T through 2 hydrogen bonds and C to G with 3 hydrogen bonds. Draw in the hydrogen bonds with a chalk marker. Look at figure 8. Label the 5' and 3' ends of the second strand. Take a photo of your completed molecule and insert it into your lab notebook. 3. Explain dehydration synthesis, including what atoms are removed, and what molecule becomes a byproduct of these reactions.arrow_forwardDraw the full structure of the DNA dinucleotide C-T. Identify the 5′ and 3′ ends of this dinucleotide.arrow_forwarddraw a picture of a SINGLE strand of DNA (a polynucleotide) composed of 9 (nine) nucleotides of your choice. Do use ALL 4 nucleotides. Use 3 simple symbols to represent the phosphate, the sugar, and the base in each nucleotide. For example, use a circle with the letter “P” for the phosphate in the backbone, a square with the letter “S” for the sugar in the backbone, and a triangle with the letter “A, T, C or G” for the bases.As you draw the diagram be sure to put solid lines for the covalent bonds you are creating to join new nucleotides to the elongating DNA chain.arrow_forward
- What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.arrow_forwardA) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the complementary base sequence for the matching strand in the DNA section shown below.5’ – C T G T A T A C G T T A – 3’ Please answer both partsarrow_forwardWrite the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY