Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 6.1, Problem 1CR
Describe why a protein that binds to a specific sequence of double-stranded DNA is unlikely to bind to the same sequence if the DNA is single-stranded.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA:
G G C T A G C T G C T T C C T T G G G G A
C C G A T C G A C G A A G G A A C C C C T
Template strand with its polarity: 3’ C C G A T C G A C G A A G G A A C C C C T 5’
- Coding strand with its polarity: 3’ G G C T A G C T G C T T C C T T G G G G A 5’
Please write out the mRNA sequence generated by the template strand to produce that polypeptide chain.
An RNA molecule has the following percentages of bases: A = 23%, U = 42%, C = 21%, and G = 14%.
Q. What would be the percentages of bases in the template strand of the DNA that contains the gene for this RNA?
Within a protein, certain amino acids are positively charged (e.g.,lysine and arginine), some are negatively charged (e.g., glutamateand aspartate), some are polar but uncharged, and some are nonpolar.If you knew that a DNA-binding protein was recognizingthe DNA backbone rather than a base sequence, which aminoacids in the protein would be good candidates for interacting withthe DNA?
Chapter 6 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 6.1 - What is protein domain?Ch. 6.1 - Why are most DMA-binding proteins specific to...Ch. 6.1 - Describe why a protein that binds to a specific...Ch. 6.2 - Why is negative control so named?Ch. 6.2 - How does a repressor inhibit the synthesis of a...Ch. 6.2 - Induction is considered the opposite of enzyme...Ch. 6.3 - Prob. 1MQCh. 6.3 - Prob. 2MQCh. 6.3 - What is the difference between an operon and a...Ch. 6.4 - Prob. 1MQ
Ch. 6.4 - Prob. 2MQCh. 6.4 - Explain how the lac operon is both positively and...Ch. 6.4 - Prob. 1CRCh. 6.5 - What is the major difference between...Ch. 6.5 - How do transcriptional activators in Archaea often...Ch. 6.5 - Explain how the Pyrococcus furiosus TrmBL1...Ch. 6.5 - Prob. 1CRCh. 6.6 - What are kinases and what is their role in...Ch. 6.6 - Prob. 2MQCh. 6.6 - Prob. 1CRCh. 6.7 - What are the primary response regulator and the...Ch. 6.7 - Why is adaptation during chemotaxis important?Ch. 6.7 - How does the response of the chemortaxis system to...Ch. 6.7 - Adaptation allows the mechanism controlling...Ch. 6.8 - What advantage do quorum-sensing systems confer on...Ch. 6.8 - Prob. 2MQCh. 6.8 - Prob. 3MQCh. 6.8 - How can quorum sensing be considered a regulatory...Ch. 6.9 - Which Escherichia coli genes are activated and...Ch. 6.9 - Prob. 2MQCh. 6.9 - What are some other conditions that trigger the...Ch. 6.9 - Explain the sequence of molecular events that...Ch. 6.10 - Prob. 1MQCh. 6.10 - Prob. 2MQCh. 6.10 - Prob. 3MQCh. 6.10 - Prob. 1CRCh. 6.11 - Prob. 1MQCh. 6.11 - Prob. 2MQCh. 6.11 - Prob. 3MQCh. 6.11 - What are the mechanisms by which regulation by...Ch. 6.12 - What happens when a riboswitch binds the small...Ch. 6.12 - What are the major differences between a repressor...Ch. 6.12 - What is the mechanism by which a riboswitch...Ch. 6.13 - Why does attenuation control not occur in...Ch. 6.13 - Prob. 2MQCh. 6.13 - Prob. 1CRCh. 6.14 - What is feedback inhibition?Ch. 6.14 - Prob. 2MQCh. 6.14 - Prob. 3MQCh. 6.14 - Describe how feedback inhibition is reversible.Ch. 6.15 - What types of covalent modifications commonly...Ch. 6.15 - Prob. 2MQCh. 6.15 - Explain the role of an anti-sigma factor.Ch. 6.15 - Which nucleotides are commonly used to covalently...Ch. 6 - What would happen to regulation from a promoter...Ch. 6 - Most of the regulatory systems described in this...Ch. 6 - Many amino acid biosynthetic operons under...Ch. 6 - How would you design a regulatory system to make...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You have isolated a fragment of viral DNA that supposedly encodes for two proteins, 196 and 220 amino acids long respectively. The isolated DNA fragment is found to be 1100 base pairs in length. Argue why is the isolated DNA cannot code the two proteins identified earlier?arrow_forwardConsider how histone proteins bind to DNA and then explain why a salt solution with a high concentration can remove them from DNA (as shown in Figure 12.21b).arrow_forwardDescribe the critical role that complementary base-pairing plays in replication, transcription, and translation.arrow_forward
- An RNA molecule has the following percentages of bases: A = 23%, U = 42%, C = 21%, and G = 14%. a. Is this RNA single stranded or double stranded? How can you tell? b. What would be the percentages of bases in the template strand of the DNA that contains the gene for this RNA?arrow_forwardThe DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?arrow_forwardIn the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:arrow_forward
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardExplain how the ability of a large, multisubunitprotein molecule to bind a specific DNA sequence can be alteredwhen it binds with a small molecule no larger than a single aminoacid.arrow_forwardDNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and thymine, denoted A, G, C, and T. A sequence of three basesiscalleda codon. A base may appear more than once in a codon. a) How many different codons are there? b) The bases A and G are purines, while C and T are pyrimidines. How many codons are there whose first and third bases are purines and whose second base is a pyrimidine? c) How many codons consist of three different bases?arrow_forward
- Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?arrow_forwardThe coding strand has the following sequence. Please answer thequestions below with regard to this coding strand.5' - A T G C C T T A C G C C C C T G G A G A C G A A A A G A A G G G T G C T A TT A C G T A T T T G A A G A A G G C C A C C T C T G A G T A A – 3'(a) What is the mRNA transcribed from this DNA sequence? What is the amino acid sequenceof the protein translated from this mRNA?(b) For some reasons, an amino acid sequence of Ala-Pro-Arg-Asp was found in the protein.Please explain how this sequence appears up in the final product.arrow_forwardWhen proteins recognize and bind to a specific sequence in DNA, why do they usually just recognize short sequences of 5-6 bases rather than 10-20 bases?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license