Biochemistry
8th Edition
ISBN: 9781464126109
Author: Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr., Lubert Stryer
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 5, Problem 3P
Interpretation Introduction
Interpretation:
The bonding pattern of the ethidium bromide to the DNA should be determined.
Introduction:
The attains are the chemical compounds that react with the biological molecules to impart a color. The stains can be specific for some biological molecules or can stain the whole cell. The ethidium bromide is a stain specific for the DNA molecule.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Need help, please. Please refer to the images attached. The questions are in the second image attached asking for basepair lengths. The first image is just for information.
Make your DNA extraction buffer. Add 2 teaspoons of detergent, 1 teaspoon of salt, and ½ cup of water to one of the plastic cups. Stir well.
4 Open the bag of fruit and add 2 teaspoons of your DNA extraction buffer. What are cell membranes made of? Which parts are hydrophobic and which are hydrophilic?
What does soap do to cell membranes? Why would this be helpful in extracting DNA?
What function does the salt perform in the solution?
Pstl.
EcoRI
Origin of
replication
(ori)
Ampicillin Tetracycline
resistance resistance
(Amp) (Tet")
pBR322
(4,361 bp)
BamHI
Pvull
Sall
Recombinant
Plasmid DNA
Bacterial cell contains...
No plasmid DNA
pBR322 (no insert)
Recombinant plasmid
00,000.
Host DNA
Transformation
of E. coli cells
+AMP plate
pBR322
Figure 7-5
+TET plate
Based on the recombinant plasmid growth pattern (bottom row of blue table), which of
the depicted plasmid's restriction sites was used to prepare this sample? Explain how
you can tell.
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedurearrow_forwardTrue or False. During gel electrophoresis, small DNA fragments are found towards the top of the gel True Falsearrow_forwardno explanation necessary! Letter of answer only. Part I: Multiple choice 1. The DNA base pairing rules are: a) Any combination of the bases. b) T pairs with C, and A pairs with G. c) A pairs with T, and C pairs with G. d) C pairs with A, and T pairs with G. 2. DNA in cells is damaged: a) Millions of times a day. b) By collisions with other molecules or by chemical accidents and radiation. c) Not very often¸ and by radiation only. d) a and b 3. For genes that code for proteins, which molecule conveys the information from the gene to the ribosome? a) DNA b) mRNA c) tRNA d) rRNA 4. Which of the molecules below is produced during replication? a) mRNA b) rRNA c) tRNA d) DNA 5. Why is there a difference between the synthesis of a lead strand and that of a discontinuous strand in DNA molecules? a) The origins of replication are found only at end 5' of the molecule. b) Helicase and protein factors act at the extremity of 5'. c) DNA polymerases can only add new nucleotides at the extremity 3' a…arrow_forward
- In DNA purification, explain how the chromosomal DNA is separated from the plasmid DNA? Be sure to mention the specific buffer components that facilitate this process.arrow_forwardu+ 2:24 * © . Fundamental of Bio-informa.. Log out DAMINOV AKHMADILLO on 3 In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are sorted is ed I out of Select one: g O 1. log2(n) on O 2. nlogn 3. n O 4. None of above 个 TOParrow_forwardRestriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’arrow_forward
- Instructions In this image, the DNA fragments traveled from top to bottom. Use the drawpad to indicate the positive (+) and negative (-) ends of the gel. Remember, DNA is negatively- charged. Use two colors to circle the shortest fragment and the longest fragment in each of the five samples. 1 2 3 4 5 ||arrow_forwardGel Electrophoresis Background and Protocol: Gel electrophoresis is a laboratory technique that separates molecules by size using an electric current. The test has a positive and negative side. Do you believe DNA should be loaded on the positive (red) side or the negative (black) side? Please explain why using scientific reasoning. Will larger DNA bands be closer or farther away from the well where you administered samples? Why?arrow_forward▼ Part A Why is the improved synthesis of nucleotide triphosphates more environmentally benign? Check all that apply. reducing the chance for reacting molecules to collide eliminates the need for polymerase chain reaction making use out of a waste product (glycerol) removal of a hazardous solvent to lower waste and costarrow_forward
- Rupinder Kaur - DNA Structure Worksheet.pdf Open with - E DNA Str Name: Missing Omubo Jack Jan Activity #20: DNA Structure 100 points der Kaur - D.. Directions: You may need your textbook to identify the nucleotides 1. Color all of the phosphates Purple 2. Color all of the deoxyriboses RED Complete through 3. Color all of the Thymines d or create Orange O Class comme 4. Color all of the Adenines Blue 5. Color all of the Cytosines Brown 6. Color all of the Guanines Green Turn in Add a class comm 7. Label the phosphates, deoxyriboses, adenines, thymines, guanines, cytosines, covalent bonds between molecules (not elements), and hydrogen nments to Omubo Jack bonds Page 2 I 2 F Q +arrow_forwardSimilarities between DNA agarose gels and SDS-PAGE are: Both methods use agarose gels. Both methods use electrical charge differences to separate molecules by size. Both methods determine the size of DNA fragments. All the given answers.arrow_forwardIn DNA extracting. What is the purpose of clear shampoo in the DNA extraction buffer?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license