Biochemistry
8th Edition
ISBN: 9781464126109
Author: Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr., Lubert Stryer
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 22P
Interpretation Introduction
Interpretation:
The explanation for the appearance of the given data at position 49 is to be stated.
Concept introduction:
The basic unit of heredity which is made up of DNA segments is known as gene. The process in which the genomic features like DNA sequence are indentified, measured and compared with others genomic features is known as genomic analysis.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
3a)ClustalX software was used to perform multiple sequence alignment of thefollowing five Nco protein sequences designated as Nco1-Nco5 (the provided figure). A pair of degenerate primers was designed to PCR-amplify a DNA segment with the size of approximately 290 bp. With justification, discuss which amino acidsequence blocks would be suitable to design the forward and reverse degenerate primers.
The team would now like to establish the smallest possible deletion that would
inactivate the function of the protein. Describe a strategy to carry out this experiment
To check their sequences, the team choses to carry out DNA sequencing themselves,
using the Sanger method. Describe the biochemical processes involved in this
technique in detail.
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- DNA precursor imbalances are mutagenic. For example, if dGTP accumulates, it can compete with dATP for incorporation opposite dTMP in the template, leading to a transition mutation. Investigators have shown that a modest balanced increase in all four dNTPs, three- or fourfold, stimulated mutagenesis out of proportion to the dNTP pool change. Describe a mechanism by which this could occur.arrow_forwardUsing text, diagrams and'or drawn structures where appropriate, briefly describe how selective depurination (i.e., loss of the base) and cleavage of the 3' and 5' phosphodiester bonds of guanine containing deoxyribonucleotides occurs in the Maxim-Gilbert DNA sequencing method.arrow_forwardDNA renaturation curves occasionally show three distinct phases of renaturation. In this graph, DNA renaturation is plotted against C0t (initialconcentration times time of renaturation—essentially a measure of relativerenaturation time). See Figure 21.3.(a) Identify each part of this plot that corresponds to reannealing of (1)unique sequences, (2) moderately repetitive sequences, and (3) highlyrepetitive sequences.(b) Suppose that you cloned a single-copy gene, such as the gene for dihydrofolate reductase (DHFR), into a plasmid vector and subjected it torenaturation analysis. Sketch the curve you might expect.(c) Suppose that you used reverse transcriptase to copy the ovalbumin mRNA and cloned this complementary DNA (cDNA) into a plasmid vector. Would you expect this cDNA to reanneal (1) more slowly, (2) more rapidly, or (3) at the same rate as genomic DNA? Briefly explain your answer.arrow_forward
- During your experiment you analysed only a few of the recombinant clones for the presence of thehighly repeated Alu elements. If you wanted to screen for a single-copy gene, you would need to screenall of a much larger genomic library. Assuming, that you already know the amino acid sequence ofunicorn (a species with a similar physiology to humans) insulin, how would you construct a probe whichwould enable you to use nucleic acid hybridisation to screen a unicorn genomic DNA library for theinsulin gene? Hint: you have access to any molecular biology reagents and equipment you might need, such as vectors,enzymes, and DNA sequencers.arrow_forwardThe chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?arrow_forwardIn the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleoside triphosphate—say, ddCTP—is added to the sequencing reaction along with a larger amount of the corresponding dCTP. What resultwould be observed if the dCTP were omitted?arrow_forward
- Ailee is interested to determine the nucleotide sequence of her bacterial heat shock gene. Hence, DNA sequencing needs to be performed for this analysis. One of the earliest methods invented is known as Sanger sequencing. Explain in detail the mechanism of this sequencing technique with the aid of a simple diagram.arrow_forwardDNA photolyases convert the energy of light in the nearultraviolet or visible region (300– 500 nm) into chemical energy to break the cyclobutane ring of pyrimidine dimers. In the absence of substrate, these photoreactivating enzymes do not absorb light of wavelengths longer than 300 nm. Why is the substrateinduced absorption band advantageous?arrow_forwardEukaryotic genomes are replete with repetitive sequences that make genome assembly from sequencereads difficult. For example, sequences such asCTCTCTCTCT . . . (tandem repeats of the dinucleotide sequence CT) are found at many chromosomallocations, with variable numbers (n) of the CT repeating unit at each location. Scientists can assemblegenomes despite these difficulties by using the pairedend sequencing strategy diagrammed in Fig. 9.9. Inother words, they can make libraries with genomicinserts of defined size, and then sequence both endsof individual clones. Following are 12 DNA sequence reads from sixcloned fragments analyzed in a genome project. 1Aand 1B represent the two end reads from clone 1, 2Aand 2B the two end reads from clone 2, etc. Clones1–4 were obtained from a library in which the genomic inserts are about 2 kb long, while the inserts inclones 5 and 6 are about 4 kb long. All of these sequences have their 5′ ends at the left and their 3′ endsat the right. To simplify…arrow_forward
- Suppose that a replicative DNA polymerase had its 3′ exonuclease site 1.5 nm from the polymerase site, rather than the 3.0 nm seen in Klenow fragment. How would this change affect the fidelity of the enzyme? Why? Describe an additional change that could give this enzyme the same fidelity as Klenow fragment while retaining the 1.5-nm inter-site distance.arrow_forwardDNA precursor imbalances are mutagenic. For example, if dGTP accumulates, it can compete with dATP for incorporation opposite dTMP in the template, leading to a transition mutation. Recently it was reported that a modest balanced increase in all four DNTPS, three- or fourfold, stimulated mutagenesis out of proportion to the DNTP pool change. Describe a mechanism by which this could осcur.arrow_forwardA linear DNA molecule is subjected to complete restriction digestion by (1) EcoRI alone, (2) HindIII alone, and (3) both enzymes together. The DNA fragments are then separated using gel electrophoresis. Results are shown below: (i) (ii) (iii) EcoRI Hindill Both | | — | | 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb How long is the original DNA molecule? How many EcoRI recognition sites does it have? Does the longest EcoRI fragment contain a HindIII restriction site? Explain your answer.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License