The variation of the usual PCR protocol that would enable an individual to amplify entirely new genomic terrain is to be stated. Concept introduction: DNA stands for deoxyribonucleic acid, is a biological macromolecule. DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine (A), thymine (T), guanine (G) and cytosine (C). The reaction that is used to make the duplicates of a particular DNA segment is known polymerase chain reaction (PCR).

Question

Want to see the full answer?

Answer 1

Question

Chapter 5, Problem 12P

Interpretation Introduction

Interpretation:

The variation of the usual PCR protocol that would enable an individual to amplify entirely new genomic terrain is to be stated.

Concept introduction:

DNA stands for deoxyribonucleic acid, is a biological macromolecule. DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine (A), thymine (T), guanine (G) and cytosine (C).

The reaction that is used to make the duplicates of a particular DNA segment is known polymerase chain reaction (PCR).

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

This is DWA. You hope to clone an extinct animal species by taking the easy route - using museum bones or tissues. You extract the DNA and use PCR to amplify, then sequence all segments of the genome You are unsuccessful. Later you discover that the museum specimens have been treated with formaldehyde, which forms covalent bonds in DNA, where once there existed H-bonds. What step in your PCR reaction would be inhibited? g -S Knowing this, if a human was exposed to formaldehyde, what enzyme(s) of DNA replication in vivo would be prevented from doing their job?

Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC

Need help, please. 1) Which primer could be used as the forward primer, for synthesizing DNA from left to right in the above diagram? Enter the number of the primer here: 2) Which primer could be used as the reverse primer, for synthesizing DNA from right to left in the above diagram? Enter the number of the primer here: 3) Will these primers be part of the final PCR product? a.No, neither primer will be incorporated into the PCR product. b.The forward primer but not the reverse primer will be incorporated into the PCR product. c.The reverse primer but not the forward primer will be incorporated into the PCR product. d.Yes, both primers will be incorporated into the PCR product.