The ovalbumin cDNA or ovalbumin genomic DNA should whether be used to form the protein in E.coli or not is to be stated. The reason corresponding to the correct choice is to be stated. Concept introduction: A segment which is located on hnRNA and cannot transfer genetic information is known as intron. A segement which is located on hnRNA and can encode single part of the mature RNA after eliminating the introns is known as exon. The protein that is mainly found in egg white and shows the 3 − D homology with the serpin is known as ovalbumin protein.

Question

Want to see the full answer?

Answer 1

Question

Chapter 5, Problem 2P

Interpretation Introduction

Interpretation:

The ovalbumin cDNA or ovalbumin genomic DNA should whether be used to form the protein in E.coli or not is to be stated. The reason corresponding to the correct choice is to be stated.

Concept introduction:

A segment which is located on hnRNA and cannot transfer genetic information is known as intron. A segement which is located on hnRNA and can encode single part of the mature RNA after eliminating the introns is known as exon.

The protein that is mainly found in egg white and shows the 3−D homology with the serpin is known as ovalbumin protein.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.

An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.

please help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosen