The explanation for the appearance of the given data at position 49 is to be stated. Concept introduction: The basic unit of heredity which is made up of DNA segments is known as gene. The process in which the genomic features like DNA sequence are indentified, measured and compared with others genomic features is known as genomic analysis.

Question

The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…

Answer 1

Question

Chapter 5, Problem 23P

Interpretation Introduction

Interpretation:

The explanation for the appearance of the given data at position 49 is to be stated.

Concept introduction:

The basic unit of heredity which is made up of DNA segments is known as gene. The process in which the genomic features like DNA sequence are indentified, measured and compared with others genomic features is known as genomic analysis.

Expert Solution & Answer

Trending nowThis is a popular solution!

See solution

Check out sample textbook solution

Students have asked these similar questions

The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…

3a)ClustalX software was used to perform multiple sequence alignment of thefollowing five Nco protein sequences designated as Nco1-Nco5 (the provided figure). A pair of degenerate primers was designed to PCR-amplify a DNA segment with the size of approximately 290 bp. With justification, discuss which amino acidsequence blocks would be suitable to design the forward and reverse degenerate primers.

The team would now like to establish the smallest possible deletion that would inactivate the function of the protein. Describe a strategy to carry out this experiment To check their sequences, the team choses to carry out DNA sequencing themselves, using the Sanger method. Describe the biochemical processes involved in this technique in detail.