Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 5, Problem 20P
Interpretation Introduction
Interpretation:
The given result of amplifying a segment of DNA by PCR with the help of the primers is to be explained.
Concept introduction:
The reaction that is used to make the duplicates of a particular DNA segment is known polymerase chain reaction (PCR).
A small single strand of DNA or RNA containing approximately
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Help Please
Supercoiled DNA migrates through an
agorose gel faster than similarly sized linear
DNA? True or False?
Using the plasmid map, indicate where (bp region on plasmid) these enzymes cut on
the plasmid.
EcoR1
1. 1
Hindlll
2. 637
Bpu101
3. 14
BamHI
4. 256
To sequence a DNA plasmid, you need 1 µg of DNA.
If your DNA concentration was 0.45 µg/µL. How many µl of your DNA 0.45 µg/µL
is required to get 1 µg final? Answer in µl using 2 decimal places.
Your Answer:
Answer
units
>
Clone number in this case is number 196 as shown in the images. What is the exact length of the segment of human DNA that has been inserted into the plasmid?
*report the entire length of the insert, not just the sequences matching the ends and labels of wells isn't needed for answer*
Can you help with 1a please
HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel.
1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to each other. This plasmid was digested with three different restriction enzymes 2000 bp 3500 bp Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the samples run on an agarose gel as shown below. Where does Bgll (B) cut this plasmid ? Does the plasmid have one recognition site or two for Bg|l? Describe the Bgll cut site in this plasmid relative to the Kpnl cut Plasmid Z -7 kb Pstl site. How many bases to the left or right of the Kpnl cut site would you observe the Bgll cut site. Explain briefly. 1500 bp Pstl Ladder Kpni Psti K/P Bgl K/B KPB 7000 bp 7000 bp 5600 bp 5500 bp 4900 bp 3500 bp 2000 bp 1500 bp 1500 bp 1500 bp 1400 bp 600 bp %3Darrow_forwardSection Name MAPPING PRACTICE #4 Plasmid pBR 607 is a 2.6 Kb plasmid containing Ampicillin and Tetracycline resistance markers, an origin of replication, and unique restriction sites for the restriction enzymes EcoRI, BamHI, and Pstl. Given the restriction map for pBR 607 for the enzymes EcoRI, BamHI, and Pstl, show on the gel diagram, where the approximate positions of the restriction fragments generated from the restriction digests would be located after carrying out electrophoresis. BamHI 0.2 Kb pBR 607 ECORI 1.94 Kb 0.46 Kb Pstl Size EcoRI EcoRI EcoRI + Standards BamHI + Pstl BamHI Pstl 4.0 Kb 2.2 Kb 2.0 Kb 0.5 Kbarrow_forwardRestriction mapping sample question You have a 5.3 kb PstI fragment cloned into the PstI site of the vector pUC19, which is 2.7 kb in size. This vector has unique sites for the following enzymes in a multiple cloning site: PstI, HincII, Xbal, BamHI, SmaI, EcoRI A restriction map of the 5.3 kb insert is prepared. The recombinant plasmid is digested with the enzymes listed above in single digests, and then several combinations of enzymes are tested in double digests. The following bands are observed when the digests are run on a gel: Enzyme(s) used PstI ECORI HincII Band sizes observed (kb) 5.3, 2.7 5.4, 2.6 4.5, 3.5 6.7, 1.3 | 4.0 (high intensity band) 3.9, 3.7, 0.4 4.0, 3.5, 0.5 3.5, 2.6, 1.9 3.7, 3.6, 0.4, 0.3 3.7, 2.2, 1.7, 0.4 3.7, 3.0, 0.9, 0.4 3.9, 3.5, 0.4, 0.2 Smal Xbal ВатHI HinclI + Xbal HincII + ECORI XbaI + BamHI ECORI + BamHI Smal + BamHI HincII + BamHI Use the data above to construct a map of the cloned insert. Note that fragments smaller than 100 bp will not usually be…arrow_forward
- Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completelyarrow_forwardHindlII ECORI ECORV BamHI 379 Sall Pstl. tet amp Plasmid PBR322 1000 4361 bp ori Ndel If you were going to use this vector to clone a foreign fragment of DNA, what two restriction enzymes would you use to cut the vector, so you could make a recombinant plasmid that has AmpR and KanR (Kanamycin resistance), but No TetR. Assume the insert DNA does NOT have a Tet resistance gene but does have a Kanamycin resistance gene. O EcoR1 and Hindll O Pst1 and Sal1 O Pst1 and Nde1 O EcoR1 and Nde1 f6arrow_forwardEntire sequence below needs to beamplified by PCR and subcloned into a plasmid vector. Which of the primersequences listed underneath is the correct reverse primer (6 marks)? Copy correctsequence into your answer. Why primer e) is not the right answer (4 marks)? 5'ATCTCTATTTAATATTTATGTCTATTTAAGCCTCATATTTAAAGACAGGGAAGAGCAGAACGGAGCCCCAGGCCTCTGTGTCCTTCCCTGCATTTCTGAGTTTCATTCTCCTGCCTGTAGCAGTGAGAAAAAGCTCCTGTCCTCCCATCCCCTGGACTGGGAGGTAGATAGGTAAATACCAAGTATTTATTACTATGACTGCTCCCCAGCCCTGGCTCTGCAATGGGCACTGGGATGAGCCGCTGTGAGCCCCTGGTCCTGAGGGTCCCCACCTGGGACCCTTGAGAGTATCAGGTCTCCCACGTGGGAGACAAGAAATCCCTGTTTAATATTTAAACAGCAGTGTTCCCCATCTGGGTCCTTGCACCCCTCACTCTGGCCTCAGCCGACTGCACAGCGGCCCCTGCATCCCCTTGGCTGTGAGGCCCCTGGACAAGCAGAGGTGGCCAGAGCTGGGAGGCATGGCCCTGGGGTCCCACGAATTTGCTGGGGAATCTCGTTTTTCTTCTTAAGACTTTTGGGACATGGTTTGACTCCCGAACATCACCGACGCGTCTCCTGCTG 3'a) 5' TTCCGGAAGAAGCTTATACGG 3'b) 5' CTGTGTTCACCTAATATTCCT 3'c) 5' CAGCAGGAGACGCGTCGGTGA 3'd) 5' AGGAATATTAGTATAATCCAC 3'e) 5' GACGCGTCGGTGATGTTCGGG 3’f) 5'…arrow_forward
- Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHIarrow_forwardDo virtual restriction digests of 300ng pGLO plasmid using HinDIII, EcoRI, and XhoI separately, and a double digest of pGLO with HinDIII plus EcoRI. How many nanograms of DNA should we expect to be contained within the slowest bandfrom the HinDIII-digest of pGLO?arrow_forwardRestriction mapping of a plasmid: Digestion of a plasmid pCHEM1234 with the following restriction enzymes (single and double-cut) resulted in the fragments below. Draw a restriction map of the plasmid using the data provided below A. PCHEM 1234. Shown below are the restriction fragments BamHI 52 kb Hind III 26, 12, 8, 6 kb BamHI and HindIII double digest 14, 12, 8, 6 kbarrow_forward
- PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCGȚAGCTATATGCTATCGTGACGTATCGGCGCATTAAȚCGGGATCGAT 3 50 3' TGGCÁTCGATATACOATAGCACTOCATAGCCGCGTAATTÀGCCCTAGCTÀ 5' 5' AGCTÇGCTAGCAGGAGAGAȚATCGÇTCATAGCTCCGATCGATGCCGCTAA 3 3' TCGAGCG ATCGTCCTCTCTÁTAGCGAGTATCGAGÓCTAGCTACGGCGATİ 5' 100 5' TATAGCTCTÇTGCGGATATÇGCATATACCẠ AGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACOCCTATAGCGTATATGGTTCCGGGATGČATACATCGAŤ 5' 5 TGCGTATATÇGGAGAGTCCTGGATATGGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCÁTATAGCCTCICAGGÁCCTATACCTCGAACTGACGTCTCTCGAGCT 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 3. ATACGCGAATCCGGCATATACGAACCCCTÍTCGAGATACATACGATACAC 5' 250 5' TGCATGTGCTATGCAACGTTCOGATTGCGȚAGCAGTAATAGCGCCGATTG 3 300 3'…arrow_forwardGive typed full explanation you made a recombinant plasmid (it is circular) that contains the sequence 5' AAGCTT in the middle of the inserted or cloned gene. that is the only place where this sequence occurs. the entire plasmif does not have 5' GAATTC. When putting this plasmid into E. coli (transformstion) what will happen? 1. plasmid will cut into several fragments 2. nothing the plasmif with remain circular 3. plasmid will be cut once making a linear dna fragment 4. will be cut once but will becomr two linear fragmentsarrow_forwardPCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCOȚAGCTATATOCTATCOTGACOTATCOGCOCATTAAȚCGGGATCGAT 3 3' TGGCATCGATATACGATAGCACTGCATAGCCGCGTAATTAGCCCTAGCTẢ 5 50 5' AGCTCGCTAGCAGGAGAGATATCGCTCATAGCTCCGATCGATGCCGCTAA 3 100 3' TCGAGCGATCGTCCICTCTATAGCGAGTAICGAGGCTAGCTACGGCGATİ 5' 5' TATAGCTCTCTGCGGATATÇGCATẠTACCAAGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACGCCTATAGCGTATATGGÍTCCGGGATGČATACATCGAŤ 5 5' TGCGȚATATÇGGAGAGTCCTGGATAT GGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCATATAGCCTCICAGGACCTATACCTCGAACÍGACGICTCTCGAGCİ 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 250 3' ATACGCGAATCCGGCATATACGAACCCCTITCGAĞATACATACG ẢTACAČ 5' 5' TGCATOTGCTATOCAACGTTC GGATTGCGȚAGCAGTAATAGCGCCGATTO 3' 300 3'…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License