Biochemistry: Concepts and Connections
Biochemistry: Concepts and Connections
1st Edition
ISBN: 9780321839923
Author: Dean R. Appling, Spencer J. Anthony-Cahill, Christopher K. Mathews
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 4, Problem 7P

For some DNAs, it is possible to separate the two strands, after denaturation, in a CsCl gradient.
a. What property of any DNA determines where it will band in a CsCl?
b. What kind of DNA might have two strands that differ sufficiently in this property that they could be separated after denaturation?

Blurred answer
Students have asked these similar questions
For some DNAs, it is possible to separate the two strands, after denaturation,in a CsCl gradient.(a) What property of any DNA determines where it will band in a CsClgradient?(b) What kind of DNA might have two strands that differ sufficiently in thisproperty that they could be separated after denaturation?
One of the useful rules of thumb that you may have learned in Biochemistry, is that a 50 g/ml solution of DNA has an absorbance of about 1.0 in a 1 cm cell.   A. I have a solution of DNA that has a transmittance of 0.15 when it is placed in a cell with a 200 um pathlength. What is the concentration of DNA in this solution? (in units of g/ml) B. Assume that this DNA is a synthetic oligo containing 25 base pairs, and that the MW of a single base pair has a molecular weight of 330. What is the molar concentration of duplex DNA molecules in the solution? C. What is the Molar absorptivity of DNA in units of L cm (mol base pair) -1 -1
Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragment
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Text book image
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Text book image
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Text book image
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license