Anatomy & Physiology: The Unity of Form and Function (Standalone Book)
7th Edition
ISBN: 9780073403717
Author: Kenneth S. Saladin Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 4, Problem 4TYC
Summary Introduction
Summary:
The length of an mRNA that coded for 300 amino acid long protein molecule.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Given the DNA sequence below:
5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’
3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’
Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
What would be the minimum length(approximate number of bases) of an mRNAthat coded for a protein 300 amino acidslong?
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’.
2a). Following transcription, what is the total number of codons in the mRNA transcript?
2 b). Where is the start codon located in this mRNA transcript?
2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
Chapter 4 Solutions
Anatomy & Physiology: The Unity of Form and Function (Standalone Book)
Ch. 4.1 - Prob. 1BYGOCh. 4.1 - Prob. 2BYGOCh. 4.1 - Prob. 3BYGOCh. 4.1 - Prob. 4BYGOCh. 4.1 - Prob. 1AYLOCh. 4.1 - Prob. 2AYLOCh. 4.1 - Prob. 3AYLOCh. 4.1 - Prob. 4AYLOCh. 4.1 - Prob. 5AYLOCh. 4.1 - Prob. 6AYLO
Ch. 4.2 - Prob. 5BYGOCh. 4.2 - Prob. 6BYGOCh. 4.2 - Prob. 7BYGOCh. 4.2 - Prob. 8BYGOCh. 4.2 - Prob. 9BYGOCh. 4.2 - Prob. 10BYGOCh. 4.2 - Prob. 1AYLOCh. 4.2 - Prob. 2AYLOCh. 4.2 - Prob. 3AYLOCh. 4.2 - Prob. 4AYLOCh. 4.2 - Prob. 5AYLOCh. 4.2 - Prob. 6AYLOCh. 4.2 - Prob. 7AYLOCh. 4.2 - Prob. 8AYLOCh. 4.2 - Prob. 9AYLOCh. 4.2 - Prob. 10AYLOCh. 4.3 - Prob. 11BYGOCh. 4.3 - Prob. 12BYGOCh. 4.3 - Prob. 13BYGOCh. 4.3 - Prob. 14BYGOCh. 4.3 - Prob. 15BYGOCh. 4.3 - Prob. 1AYLOCh. 4.3 - Prob. 2AYLOCh. 4.3 - Prob. 3AYLOCh. 4.3 - Prob. 4AYLOCh. 4.3 - Prob. 5AYLOCh. 4.3 - Prob. 6AYLOCh. 4.3 - Prob. 7AYLOCh. 4.4 - Prob. 16BYGOCh. 4.4 - Prob. 17BYGOCh. 4.4 - Prob. 18BYGOCh. 4.4 - Prob. 1AYLOCh. 4.4 - Prob. 2AYLOCh. 4.4 - Prob. 3AYLOCh. 4.4 - Prob. 4AYLOCh. 4.4 - Prob. 5AYLOCh. 4.4 - Prob. 6AYLOCh. 4.4 - Prob. 7AYLOCh. 4.4 - Prob. 8AYLOCh. 4.4 - Prob. 9AYLOCh. 4.4 - Prob. 10AYLOCh. 4.4 - Prob. 11AYLOCh. 4.4 - Prob. 12AYLOCh. 4.4 - Prob. 13AYLOCh. 4.4 - Prob. 14AYLOCh. 4 - Production of more than one phenotypic trait by a...Ch. 4 - When a ribosome reads a codon on mRNA, it must...Ch. 4 - Prob. 3TYRCh. 4 - Two genetically identical strands of a metaphase...Ch. 4 - Prob. 5TYRCh. 4 - Genetic transcription is performed by a....Ch. 4 - Prob. 7TYRCh. 4 - Prob. 8TYRCh. 4 - Semiconservative replication occurs during a....Ch. 4 - Mutagens sometimes cause no harm to cells for all...Ch. 4 - The cytoplasmic division at the end of mitosis is...Ch. 4 - Prob. 12TYRCh. 4 - Prob. 13TYRCh. 4 - Prob. 14TYRCh. 4 - Prob. 15TYRCh. 4 - Prob. 16TYRCh. 4 - Prob. 17TYRCh. 4 - The cytoplasmic granule of RNA and protein that...Ch. 4 - Prob. 19TYRCh. 4 - Prob. 20TYRCh. 4 - Prob. 1BYMVCh. 4 - Prob. 2BYMVCh. 4 - Prob. 3BYMVCh. 4 - Prob. 4BYMVCh. 4 - Prob. 5BYMVCh. 4 - Prob. 6BYMVCh. 4 - Prob. 7BYMVCh. 4 - Prob. 8BYMVCh. 4 - Prob. 9BYMVCh. 4 - Prob. 10BYMVCh. 4 - Prob. 1TFCh. 4 - Steroids, carbohydrates, and phospholipids are...Ch. 4 - Prob. 3TFCh. 4 - Prob. 4TFCh. 4 - Prob. 5TFCh. 4 - The law of complementary base pairing describes...Ch. 4 - Prob. 7TFCh. 4 - Prob. 8TFCh. 4 - Prob. 9TFCh. 4 - Prob. 10TFCh. 4 - Why world the supercoiled, condensed form of...Ch. 4 - Prob. 2TYCCh. 4 - Given the information in this chapter, present an...Ch. 4 - Prob. 4TYCCh. 4 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is the molecular weight of an MRNA that codes for the protein of molecular weight 75000KD? (Assume the molecular weight of an amino acid residue is 120 Da)arrow_forwardAssume 102 nucleotide pairs of DNA to be responsible for transcription of particular mRNA molecule. What is the length of that mRNA in (1) angstrom? (2) in micrometers?arrow_forwardWhat is the total size of the mature i.e. fully processed mRNA in nucleotides? How many amino acids would the encoded protein be? Assume that the N- terminal Met encoded by the AUG start codon, is NOT cleaved from the protein?arrow_forward
- For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'arrow_forwardConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forwardif a protein that contain the two codon sequences showed a molar mass of 97,313 g /mol and the UV data showed that it contains 0.67 % Tyrosine amino acid by weight. How many Tyrosine amino acids this protein contain? If this protein that was formed contains a total of 865 amino acids long, how many nucleic acids are there in the mRNA including the initiator and the terminator codons?arrow_forward
- Methionine is used as the first amino acid for a particular polypeptide, but it is removed during the translation process in this case. After removal of the methionine, the final polypeptide is 246 amino acids in length. How many nucleotides were used to provide the genetic coding for this particular peptide chain? Explain your answer and be sure to account for the initiation and termination of the translation process.arrow_forwardThe mass of mRNA that has copied a segment of DNA is 36,000 units, the mRNA is placed in the ribosome and represents 60% of it. Determine the mass of the protein encoded by the gene, if the mass of the amino acid is 110 and the mass of the nucleotide is 300.arrow_forwardA template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is the sequence of the complementary mRNA strand? 3 po 2) What is the sequence of the coding DNA strand? 3) After translation was complete, the resulting polypeptide underwent post-translational modification wherein the N-terminal Met residue was removed from the polypeptide. Using one-letter abbreviations, write out the resulting amino acid sequence of the polypeptide after post-translational modification.arrow_forward
- If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the amino acid sequence it would make? Note: Use one-letter abbreviation for the amino acid sequence Sample answer format: MIGHTYarrow_forwardUsing the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUarrow_forwardAssume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license