Assume 102 nucleotide pairs of DNA to be responsible for transcription of particular mRNA molecule. What is the length of that mRNA in (1) angstrom? (2) in micrometers?

Q: What is meant by the statement “The genetic code is universal”? What is the significance of this…

A: Genetic code is the code for the expression or improvisation of proteins which comes from DNA via…

Q: Given the amino acid chain below, get the (a) translation strand, (b) transcription strand strand,…

A: DNA is double stranded. There one strand is the template strand and the other is non-template. From…

Q: Based on image of protein (enzyme), need to know: a) Number of amino acids and length (Angstroms)…

A: We are given the tertiary structure of a protein (enzyme). Here; the grey spheres indicate carbon…

Q: In eukaryotic cells, secreted proteins are initially directed to the endoplasmic reticulum and then…

A: Introduction The secretory pathway refers to the endoplasmic reticulum, Golgi apparatus and the…

Q: A group of researchers isolate 'Protein X' from the wall of a human stomach with the intent of…

A: The protein is an extremely complex substance which consist of amino acid residues jointed by…

Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the…

A: Gene is a sequence of nucleotides that encode a particular protein. The transcription and…

Q: In EUKARYOTIC translation, how does initiation of translation occur? a) What components of the…

A: The process of decoding the genetic information carried by mRNA molecules in order to synthesize…

Q: The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S…

A: Ribosomes are complex molecules that are composed of ribosomal RNA molecules where photosynthesis…

Q: What is exact location of centrosome?

A: A centrosome is a cellular organelle found only in animal cells. It serves as the major…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: A eukaryotic mRNA has 1066 total nucleotides. 50 of these are the 5'UTR and 50 of these are the…

A: In a mature transcript, there are 5' untranslated (UTR) regions and 3' UTR which do not code for any…

Q: Gene editing is also used to explore the structure and function ofproteins. For example, changes can…

A: From the observations, it gets clear that the amino acid aspartate shows the most functional…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: After translation a protein needs to be folded correctly in order to function properly: C) What…

A: Proteins are long chains of amino acids. There are 4 types of proteins based on their structure:…

Q: For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the…

A: Translation refers to the process of polymerisation of amino acid to form a polypeptide. The order…

Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…

A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.

Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…

A:

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: If DNA concentration is 2 grams, what would be the molar concentration of human DNA in a human cell?

A: Introduction: DNA, or deoxyribonucleic acid, is the genetic substance found in humans and virtually…

Q: How many codons would exist in a genetic code that had codons that were four bases long? Why? (show…

A: The rules governing the encoding of genetic information in the DNA of living things are known as the…

Q: A certain membrane protein is found on the ER membrane with the N-terminus on the ER side of the…

A: This question is about the orientation of a particular membrane protein within the endoplasmic…

Q: Explain briefly how translation is initiated from a) prokaryotic mRNA and b) eukaryotic mRNA.…

A: The translation is the process of using the genetic information in mRNA to create a protein. In the…

Q: According to wobble rules, what codons should be recognized by the follow- ing anticodons? What…

A: Wobble pairing was defined as the base-pairing with two nucleotides that do not follow Watson-Crick…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: What is the “second genetic code”?

A: The genetic code is the set of rules used by living cells to translate information encoded within…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…

A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…

Q: You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several…

A: Marshall Nirenberg studied the genetic codes for protein synthesis in his biochemical research. He…

Q: As we focused on the translation of mRNA into proteins as well as on protein structure and function.…

A: mRNA It is subtype of RNA. Am mRNA molecule carries a portion of the DNA code to other parts of the…

Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…

A: Within the biological system, the flow of genetic information is explained as molecular biology's…

Q: In eukaryotic cells, the length of the transcribed RNA is almost equal to the corresponding DNA…

A: Eukaryotic cells are huge and sophisticated creatures having a nucleus encased within the nuclear…

Q: Explain how a peptide bond is formed in translation elongation in terms of: a) Which enzyme…

A: Introduction  Peptide bonds are covalent bonds that link two amino acids together to form a peptide…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.