Determine which amino acid will be incorporated into the polypeptide product. And what will be relative abundances of these amino acids in the product. Concept Introduction: Amino acids are compounds containing amino as well as acidic group. The general molecular structure of an amino acid is as follows: NH 2 -CHR-COOH Here, R is different group for different amino acids. If there is more than one amino group present in an amino acid, they are considered as basic amino acids and if there is more than one carboxylic group then they are considered as acidic amino acids.

Question

Want to see the full answer?

Answer 1

Question

Chapter 30, Problem 2P

Interpretation Introduction

Interpretation:

Determine which amino acid will be incorporated into the polypeptide product. And what will be relative abundances of these amino acids in the product.

Concept Introduction:

Amino acids are compounds containing amino as well as acidic group. The general molecular structure of an amino acid is as follows:

NH2-CHR-COOH

Here, R is different group for different amino acids. If there is more than one amino group present in an amino acid, they are considered as basic amino acids and if there is more than one carboxylic group then they are considered as acidic amino acids.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3

Using Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.

8.4 Post translational modification The following diagram shows three different types of post translational modification that can occur in proteins. Proteolysis: Phosphorylation: Glycosylation: Cleaving of polypeptide chains The addition of phosphate groups to proteins The addition of sugar groups Label the diagram to demonstrate what type of post-translational modification has taken place to the protein chain. Translation Posttranslational processing eor What organelle is responsible for post translational modification?