Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 30, Problem 4P
Codon-Anticodon Recognition: Base-Pairing Possibilities
(Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair. (b) a C:G base pair. (C) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
1
Analyzing mRNA Sequences
1. Analyze the following amino acid sequence and write
down a potential mRNA sequence from which this
sequence might have been translated. Use the codon table
in your book to determine a possible mRNA sequence.
Amino Acid Sequence 1:
H,N*-Methionine-Valine-Histidine-Leucine-
Threonine-Proline-Glutamic Acid-Glutamic Acid-
COO
2. (a) Consider Amino Acid Sequence 2. How is Amino
Acid Sequence 2 different from Amino Acid Sequence 1?
Amino Acid Sequence 2:
H,N*-Methionine-Valine-Histidine-Leucine-
Threonine-Proline-Valine-Glutamic Acid-CO
(b) Write a potential mRNA sequence for Amino Acid
sequence 2, using the same codons for any given amino
acid if it is present in both sequences.
5’-GGC TAC GTA ACT TGA TAA-3’
(a) mRNA codons that are transcribed from the DNA (b) tRNA anticodons for each of the mRNA codons (c) The sequence of amino acids in the resulting polypeptide. (d) Provide the sequence of another possible DNA strand that will lead to synthesis ofthe same polypeptide.
Chapter 30 Solutions
Biochemistry
Ch. 30 - Prob. 1PCh. 30 - Prob. 2PCh. 30 - The Second Genetic Code Review the evidence...Ch. 30 - Codon-Anticodon Recognition: Base-Pairing...Ch. 30 - Consequences of the Wobble Hypothesis Point out...Ch. 30 - Prob. 6PCh. 30 - Prob. 7PCh. 30 - Prob. 8PCh. 30 - Prob. 9PCh. 30 - The Consequences of Ribosome Complexity Eukaryotic...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwarduestion 12 of 30 > Attempt 2 5'-GGU-3',5'-AAG-3',5'-IAC-3',5'-UGU-3', and 5'-CAA-3'. Give all A series of tRNAs have the anticodons, possible codons with which each tRNA can pair. Consider the wobble rules listed in the table. First position of anticodon C G A U I Third position of codon G U or C U A or G A, U, or C 5'-GGU-3' 5'-AAG-3' 5'-IAC-3' 5'-UGU-3' 5'-CAA-3' 3'-UUU-5' 3'-GUU-5' 3'-UUC-5' 3'-GUG-5' 3'-UUG-5' Answer Bank 3'-ACA-5' 3'-AAA-5' 3'-CUG-5' 3'-GCA-5' 3'-CCA-5' 3'-ACG-5' 3'-UGU-5' 3'-CCC-5' 3'-UCA-5' 3'-AUG-5'arrow_forwardExplain translation more depth please im really confusedarrow_forward
- B PLEASE second onearrow_forwardFill up correct options.arrow_forwardGive typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license