CAMPBEL BIOLOGY:CONCEPTS & CONNECTIONS
10th Edition
ISBN: 9780136538820
Author: Taylor
Publisher: INTER PEAR
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 3, Problem 12TYK
Sucrose is broken down in your intestine to the monosaccharides glucose and fructose, which are then absorbed into your blood. What is the name of this type of reaction? Using this diagram of sucrose, show how this would occur.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which products of fat hydrolysis would cause a change in pH of the whole milk sample?
Why does a person with a low production of stomach HCl have difficulty with protein digestion?
Write the equation for the action of Pancreatin (lipase) on a molecule of Tristearin.
Suppose that after you mixed 10 mL of milk with 1 mL of lactase solution and waited three
minutes, you found that your mixture of milk and lactase contained glucose. What are two possible interpretations of this result? (Hint: Think about the possibility that, before digestion, milk
contains either a disaccharide or a monosaccharide.)
Name two disaccharides and describe the digestion (hydrolysis) of these two disaccharides.
Chapter 3 Solutions
CAMPBEL BIOLOGY:CONCEPTS & CONNECTIONS
Ch. 3 - Complete the following table to help you review...Ch. 3 - A glucose molecule is to starch as (Explain your...Ch. 3 - What makes a fatty acid an acid? a. It does not...Ch. 3 - Cows can derive nutrients from cellulose because...Ch. 3 - Of the following functional groups, which is/are...Ch. 3 - Prob. 6TYKCh. 3 - Prob. 7TYKCh. 3 - Prob. 8TYKCh. 3 - Which structural level of a protein would be least...Ch. 3 - Circle and name the functional groups in this...
Ch. 3 - Most proteins are soluble in the aqueous...Ch. 3 - Sucrose is broken down in your intestine to the...Ch. 3 - Explain the role of complementary base pairing in...Ch. 3 - What are the two types of secondary structures...Ch. 3 - The diversity of life is staggering. Yet the...Ch. 3 - How can a cell make many different kinds of...Ch. 3 - Given that the function of egg yolk is to nourish...Ch. 3 - Enzymes usually function best at an optimal pH and...Ch. 3 - SCIENTIFIC THINKING Another aspect of the Nurses...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A glycogen polymer and an amylopectin polymer, each containing 100 monosaccharide subunits, are cleaved completely by an enzyme. How many individual glucose molecules are created during this process?arrow_forwardMaltase is an enzyme that catalyzes the hydrolysis of the disaccharide maltose. This process occurs during human digestion when maltase is secreted by the intestine and then converts maltose into glucose. Which two classes of biomolecules are directly involved in this process?arrow_forwardName the process of formation of glucose from non carbohydrates.arrow_forward
- The enzyme phosphofructokinase transfers a phosphate from ATP to the hydroxyl group a C1 of fructose. Similar to fructose, water also has a hydroxyl group and the concentration of water is much higher than that of fructose. Explain why the phosphate is transferred to fructose and not to water.arrow_forwardAn individual consumes a bag of plantain chips fried in coconut oil (Yes, it happens, and it's delicious!). Plantains are "cooking bananas" that, when unripe, are full of starch (glucose sub-units). Coconut oil is mainly composed of the fatty acid palmitic acid (C16:0). Let's say that he ate the equivalent of 15,000 molecules of glucose (from starch digestion) and 20,000 molecules of palmitic acid. Almost immediately, he goes running and weight-lifting, ensuring that all the glucose from starch and all the palmitic acid are transported to skeletal muscle cells. 10 Assume the following: • You net 2 ATP and 2 NAH from the glycolysis of 1 glucose molecule, You net 3 ATPs per NADH and 2 ATPs per FADH», There is no cost for NADH transport from the cytosol into mitochondria, nor is there a cost for GTP _ ATP conversion. ( a)) How many total number of ATPs did the individual's skeletal muscle cells make from the nutrients obtained from this snack? Type calculations clearlyarrow_forwardWhen glucose is reduced, only one alditol is produced.When fructose undergoes the same reaction, however,two diasteriomeric sugars are produced. Draw theirstructures.arrow_forward
- Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forwardWrite the chemical reactions of the following Reaction of glucose with Fehling’s Reaction of sucrose with Tollen’sarrow_forwardThe enzyme sucrase splits the disaccharide sugar sucrose into the monosaccharides glucose and fructose. What prevents the glucose and fructose molecules from reentering the active site and reforming a sucrose molecule?arrow_forward
- Explain the Formation of the disaccharides lactose and sucrose.arrow_forwardÑame the specific molecules that are produced when sucrose is broken downarrow_forwardThe aldolase reaction cleaves fructose-1,6-bisphosphate to make G-3-P and DHAP. Draw the structures of the reactants and the products in the space below.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Metabolic Pathways; Author: Wisc-Online;https://www.youtube.com/watch?v=m61bQYio9ys;License: Standard Youtube License