Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 28, Problem 11P
Interpretation Introduction
Interpretation:
The change in the helical twist of the DNA,
Concept introduction:
The spiral structure of deoxyribonucleic acid may be a low energy type that makes its formation
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
do answer correctly and explain.
1 of 1
Q3.
An H-DNA region has one all
purine (blue) and one all pyrimidine
(brown) strand, allowing it to form a triple-
stranded helix by doubling back. Draw the
detailed chemical structures for all the base-
pairing (Watson-Click paring + Hoogsteen
paring) in the triple helix shown in the
figure.
5' Pyr-GTAGGAGCGG-
3 Pur-CATCCTGGCC
5 3
Pur Pyr
Question. What would the forward primer sequence look like if it were intended to
bind the area of the DNA template?
Chapter 28 Solutions
Biochemistry
Ch. 28 - Semiconservative or Conservative DNA Replication...Ch. 28 - The Enzymatic Activities of DNA Polymerase I (a)...Ch. 28 - Multiple Replication Forks in E. coli I Assuming...Ch. 28 - Multiple Replication Forks in E. coli II On the...Ch. 28 - Molecules of DNA Polymerase III per Cell vs....Ch. 28 - Number of Okazaki Fragments in E. coli and Human...Ch. 28 - The Roles of Helicases and Gyrases How do DNA...Ch. 28 - Human Genome Replication Rate Assume DNA...Ch. 28 - Heteroduplex DNA Formation in Recombination From...Ch. 28 - Homologous Recombination, Heteroduplex DNA, and...
Ch. 28 - Prob. 11PCh. 28 - Prob. 12PCh. 28 - Chemical Mutagenesis of DNA Bases Show the...Ch. 28 - Prob. 14PCh. 28 - Recombination in Immunoglobulin Genes If...Ch. 28 - Helicase Unwinding of the E. coli Chromosome...Ch. 28 - Prob. 17PCh. 28 - Functional Consequences of Y-Family DNA Polymerase...Ch. 28 - Figure 28.11 depicts the eukaryotic cell cycle....Ch. 28 - Figure 28.41 gives some examples of recombination...Ch. 28 - Prob. 21PCh. 28 - Prob. 22P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Number of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an “average� human chromosome?arrow_forwardA diploid human cell contains approximately 6.4 billion base pairs of DNA. Q.How many histone proteins are complexed with this DNA?arrow_forward4a in context to taking genomic DNA from eukaryotic cells and randomly shearing it into pieces of a constant size, why do some of the genomic DNA fragments re-nature so much more quickly than other fragmentsarrow_forward
- Give typing answer with explanation and conclusionarrow_forwardPls help ASAP.arrow_forwardX The phosphates that make up the phosphodiester bonds in DNA have pKa≈ 2. The genome of the blue crab is 800 million-base-pairs long. What is its total charge on the blue crab genome in aqueous buffer solution when the pH is equal to 2.25?arrow_forward
- A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in inarrow_forwardCOMPLEMENTARY BASE PAIRING 1. A B. C. D. E. F OMPTON 2. A. Under each sequence of bases, write the sequence of bases complementary to each section of DNA in the virus 77174: ATG TGTCA AAGACGGT CCTGTTTTGTA CCGTCAGGATTGA 6 GTTTTCATGCCTCCAAATCTT 10 The DNA of each species has a different base composition. Find the base composition of each species, using what you know about complement Human DNA is approximately 20%Carrow_forwardHelicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.arrow_forward
- Restriction mapping of the delta chromosome I need help with question two pleasearrow_forwardO Off target effects are not really a concern. Question 20 What happens after a double stranded break is induced in the DNA? Select the statement that is FALSE. O HR which will lead to a small indel if template DNA is absent O Microhomology-Mediated End Joining O Non-Homologous End Joining O HR if template DNA is present Question 21 See below for four STR profiles from four different boys, as depicted in an electropherogram. The peak localarrow_forward1a. What do DNA polymerases need to be able to synthesize a new strand of DNA? In 1970, Fred Sanger and colleagues published a DNA sequencing procedure based on the principles of DNA replication. This procedure uses in vitro DNA synthesis in the presence of radioactive nucleotides and specific chain-terminators. These specific chain terminators lack a 3' hydroxyl group and are called 2', 3' – dideoxyribonucleoside triphosphates. This means that once a chain terminator is built into the newly synthesized strand, no further synthesis can occur on that particular strand. They are most usually labelled with radioactive 355 (isotope 35 of sulphur). Four reactions are assembled, each containing one each of 2', 3' - dideoxythymidine triphosphate (ddTTP), ddCTP, ddATP or ddGTP. In each reaction tube, all the fragments will end with same base (T, C, A or G). These reactions are each loaded in their own lane and separated by gel electrophoresis, exposed to autoradiograph film (X-ray film) and…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license