Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
8th Edition
ISBN: 9780134015187
Author: John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 27, Problem 27.9UKC
List the four types of noncoding DNA (see Section 27.2). Give the function of each, if it is known.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
List the four types of noncoding DNA (see Section 27.2). Give the function of each, if it is known.
Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must be present in the informational DNA strand to code for preproinsulin (assuming no introns are present)?
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA:
3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'
Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________
Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47:
mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-
polypeptide chain: ________--________--________--________--________--________--________--________
Chapter 27 Solutions
Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
Ch. 27.1 - Decode the following sequence of letters to find...Ch. 27.3 - Prob. 27.1CIAPCh. 27.3 - Prob. 27.2CIAPCh. 27.3 - Prob. 27.3CIAPCh. 27.3 - Prob. 27.2KCPCh. 27.4 - Prob. 27.3PCh. 27.4 - A restriction enzyme known as EcoRI cuts DNA in...Ch. 27.4 - Prob. 27.5PCh. 27.5 - Classify the following activities according to the...Ch. 27.5 - Prob. 27.4CIAP
Ch. 27.5 - Prob. 27.5CIAPCh. 27.5 - Prob. 27.6CIAPCh. 27 - What steps are necessary in the mapping of the...Ch. 27 - Prob. 27.8UKCCh. 27 - List the four types of noncoding DNA (see Section...Ch. 27 - In general, what are the differences between...Ch. 27 - What is recombinant DNA? How can it be used to...Ch. 27 - Identify some major potential benefits of the...Ch. 27 - Prob. 27.13APCh. 27 - Prob. 27.14APCh. 27 - Prob. 27.15APCh. 27 - Prob. 27.16APCh. 27 - Prob. 27.17APCh. 27 - Prob. 27.18APCh. 27 - Prob. 27.19APCh. 27 - You may have heard of Dolly, the cloned sheep...Ch. 27 - Prob. 27.21APCh. 27 - Prob. 27.22APCh. 27 - What is the role of the enzyme telomerase? In what...Ch. 27 - Prob. 27.24APCh. 27 - Prob. 27.25APCh. 27 - Prob. 27.26APCh. 27 - Prob. 27.27APCh. 27 - What is a SNP?Ch. 27 - How are SNPs linked to traits in individual human...Ch. 27 - List some potential biological effects of SNPs.Ch. 27 - Prob. 27.31APCh. 27 - Prob. 27.32APCh. 27 - Prob. 27.33APCh. 27 - Prob. 27.34APCh. 27 - Prob. 27.35APCh. 27 - Prob. 27.36APCh. 27 - Prob. 27.37APCh. 27 - Prob. 27.38APCh. 27 - In the formation of recombinant DNA. a restriction...Ch. 27 - Give the sequence of unpaired bases that would be...Ch. 27 - Are the following base sequences sticky or not...Ch. 27 - Prob. 27.42APCh. 27 - Prob. 27.43APCh. 27 - Provide two examples of genetically engineered...Ch. 27 - Prob. 27.45APCh. 27 - Why is the field of bioethics so important in...Ch. 27 - Prob. 27.47CPCh. 27 - Prob. 27.48CPCh. 27 - Prob. 27.49CPCh. 27 - Prob. 27.50CPCh. 27 - What is a restriction endonuclease?Ch. 27 - Prob. 27.52CPCh. 27 - Prob. 27.53GPCh. 27 - One of the most actively pursued areas in genomics...Ch. 27 - Prob. 27.55GP
Additional Science Textbook Solutions
Find more solutions based on key concepts
1. Suppose a chloride ion and a sodium ion are separated by a center—center distance of 5 Å. Is
the interactio...
Biochemistry: Concepts and Connections (2nd Edition)
1. Suppose a chloride ion and a sodium ion are separated by a center—center distance of 5 Å. Is
the interactio...
Biochemistry: Concepts and Connections
The appearance of glucose in the urine a. occurs normally. b. indicates the presence of kidney disease. c. occu...
Human Physiology
On cold, clear nights horses will sleep under the cover of large trees. How does this help them keep warm?
University Physics Volume 2
2. Why is it that the range of resting blood pressures of humans is best represented by a bell-shaped curve co...
Human Biology: Concepts and Current Issues (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:arrow_forwardThe DNA molecules in eukaryotes including humans are negatively supercoiled while that in prokaryotes and viruses is positively supercoiled. (true/false, explain)arrow_forwardWrite the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATarrow_forward
- Describe the three important of the protein DnaA.arrow_forwardWrite the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA TGTGCGCGCGGGGCGarrow_forwardin the DNA of certain bacterial cells, 13% of the nucleotides are adenine. What are the percentages of the other nucleotides?arrow_forward
- Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?arrow_forwardIntroduction: The enzyme deoxyribonuclease I (DNase I) is an endonuclease that hydrolyzes the phosphodiester bonds of the double-stranded DNA backbone to yield small oligonucleotide fragments. DNase I is used therapeutically to treat patients with cystic fibrosis (CF). The DNase I enzyme is inhaled into the lungs where it then acts upon the DNA contained in the viscous sputum secreted by the lungs in these patients. Hydrolysis of high molecular weight DNA to low molecular weight DNA in the sputum decreases its viscosity and improves lung function. Animal studies have shown that DNase I is also effective in treating the autoimmune disease systemic lupus erythematosus (SLE). In this disease, the DNA secreted into the serum provokes an immune response. DNase I prevents the immune response by degrading the DNA to smaller fragments that are not recognized by the immune system. Genentech, Inc., the company that produces the recombinant DNase I, was interested in improving the efficiency of…arrow_forwardDescribe the three important functions of DnaA protein.arrow_forward
- Introduction: The enzyme deoxyribonuclease I (DNase I) is an endonuclease that hydrolyzes the phosphodiester bonds of the double-stranded DNA backbone to yield small oligonucleotide fragments. DNase I is used therapeutically to treat patients with cystic fibrosis (CF). The DNase I enzyme is inhaled into the lungs where it then acts upon the DNA contained in the viscous sputum secreted by the lungs in these patients. Hydrolysis of high molecular weight DNA to low molecular weight DNA in the sputum decreases its viscosity and improves lung function. Animal studies have shown that DNase I is also effective in treating the autoimmune disease systemic lupus erythematosus (SLE). In this disease, the DNA secreted into the serum provokes an immune response. DNase I prevents the immune response by degrading the DNA to smaller fragments that are not recognized by the immune system. Genentech, Inc., the company that produces the recombinant DNase I, was interested in improving the efficiency of…arrow_forwardIn a single strand of DNA, is it ever possible for the number of adenines to be greater than the number of thymines? Describearrow_forwardFor the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY