Human Biology: Concepts and Current Issues (8th Edition)
8th Edition
ISBN: 9780134042435
Author: Michael D. Johnson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17, Problem 2AWK
Summary Introduction
To review:
“Doublet code” coding for one amino acid would be sufficient or not.
Introduction:
RNA (ribonucleic acid) refers to a
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and thymine, denoted A, G, C, and T. A sequence of three basesiscalleda codon. A base may appear more than once in a codon. a) How many different codons are there? b) The bases A and G are purines, while C and T are pyrimidines. How many codons are there whose first and third bases are purines and whose second base is a pyrimidine? c) How many codons consist of three different bases?
The sequence of a polypeptide is determined by the order of codons that specify
the amino acids in the polypeptide. How many different sequences of codons can
specify the polypeptide sequence methionine-histidine-lysine? (Use the table to
find the number of possibilities.)
SECOND BASE
UAU
UACFTyrosine (Tyr)
UAA -Stop codon
UAG -Stop codon
UUUL
UGU
Cysteine (Cys)
UCU
uc
UCA FSerine (Ser)
uca
Uuc
Phenylalanine (Phe)
UUAL Leucine (Leu)
CAU
CAC
CAA Glutamine (Gin)
CAGF
UGA -Stop codon
uaa -Tryptophan (Trp)
CGU
сос
CGA FArginine (Arg)
CU
CU
Histidine (His)
CuA FLeucine (Leu)
Cua)
Proline (Pro)
CCA
cca
AAU Asparagine (Asn)
AGU Serine (Ser)
AGC
AUU
ACU
ACC
Threonine (Thr)
AACF
AAA
AAGLysine (Lys)
AUC Fisoleucine (lle)
AUA
Methionine (Met)
AUG -
Start codon
ACA
ACG
AGA
AGGFArginine (Arg)
GU
GACAspartic acid (Asp)
GGA
GAA Glutamic acid (Glu) Gaa)
GcU
-Valine (Val)
G GUA
GCA FAlanine (Ala)
Glycine (Gly)
8.
1
4
THIRD BASE
2.
FIRST BASE
What is meant by the statement “The genetic code is universal”? What is the significance of this finding?
Chapter 17 Solutions
Human Biology: Concepts and Current Issues (8th Edition)
Ch. 17 - How do you feel about the creation and then...Ch. 17 - How far should we go–to what lengths and at what...Ch. 17 - Describe how DNA is replicated before cell...Ch. 17 -
2. Compare and contrast the processes of...Ch. 17 - Explain what mutations are and the role of DNA...Ch. 17 - Name the four phases of mitosis and describe...Ch. 17 -
5. Explain why only one large egg is formed...Ch. 17 - Describe what is meant by selective gene...Ch. 17 - Explain how factors present in the environment can...Ch. 17 - Describe how ribosomes contribute to the formation...
Ch. 17 - Prob. 9CRCh. 17 - Prob. 10CRCh. 17 - What would be the outcome if a cell completed...Ch. 17 - Prob. 2TYCh. 17 - Prob. 3TYCh. 17 - Prob. 4TYCh. 17 - Which of the following are listed in order from...Ch. 17 - Prob. 6TYCh. 17 - Which is likely to be the shortest chain of...Ch. 17 - How many different amino acids could be encoded if...Ch. 17 - Prob. 9TYCh. 17 - Why do cells within an organism differentiate,...Ch. 17 - Which method of cloning is most similar to the way...Ch. 17 - Prob. 12TYCh. 17 - Prob. 13TYCh. 17 - Prob. 14TYCh. 17 -
15. How does the production of sperm differ from...Ch. 17 - Prob. 1AWKCh. 17 - Prob. 2AWKCh. 17 - Prob. 3AWKCh. 17 - Prob. 4AWKCh. 17 - Mitochondria contain their own DNA that is...Ch. 17 - Bacteria can reproduce by simple cell division....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What does it mean when we say that the genetic code contains degeneracy? Discuss the universality of the genetic code.arrow_forwardThe genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?arrow_forwardCodons in the set CUU, CUC, CUA, and CUG all code for the amino acid leucine. In this set, the first and second bases are identical; the identity of the third base is irrelevant. For what other sets of codons is the third base also irrelevant? For what amino acid(s) does each set code?arrow_forward
- An RNA molecule has the following percentages of bases: A = 27%, U = 38%, C=20%, G = 15%. (A) Is this RNA molecule single-stranded or double stranded? How can you tell? (B) What would be the percentage of each of the bases in the template strand of the DNA that contains the gene for this RNA?arrow_forwardThe genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?arrow_forwardHow many codons would exist in a genetic code that had codons that were four bases long? Why? (show the equation for calculation)arrow_forward
- An RNA molecule has the following percentages of bases: A = 23%, U = 42%, C = 21%, and G = 14%. Q. What would be the percentages of bases in the template strand of the DNA that contains the gene for this RNA?arrow_forwardThe genetic information contained in DNA consists of a linear sequence of coding units known as codons. Each codon consists of three adjacent DNA nucleotides that corresponto a single amino acid in a protien. The E.coli DNA molecule contains 4.70 x 10^6 base pairs. Determine the number of codons that can be present. Assuming that the average protein in E.coli consists of a chain of 400 amino acids, calculate the maximum number of protiens that can be coded by an E.coli DNA molecule.arrow_forwardThe genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to encode each amino acid?arrow_forward
- Please by using the first base of each as the first triplet in a condo, how do I translate two almost identical RNA strand into sequences? You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaaccarrow_forwardA group of 3 nucleotides codes for one amino acid. How many codons are needed to make the polypeptide that results?arrow_forwardWhy can the genetic code be qualified as a “degenerate code”?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license