Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 3AQ
Imagine that you have been given several bacterial strains from various countries around the world and that all the strains are thought to cause the same gastrointestinal disease and to be genetically identical. Upon carrying out a DNA fingerprint analysis of the strains, you find that four different strain types are present. What methods could you use to test whether the different strains are actually members of the same species?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You are given two samples of DNA, one from Clostridium perfringens and the other from
Mycobacterium tuberculosis. Unfortunately, the labels on the tubes of DNA were accidentally
removed, and you do not know which DNA sample belongs to which organism. As you were
doing some work with Escherichia coli in the lab, you also have some of its DNA available as
well. The %G + %C values for each of the organisms is known (C. perfringens, 27%; M.
tuberculosis, 67%; E. coli, 50%). Based upon this information, how could you quickly
determine the source of the DNA for your two samples?
You culture bacteria from the soil at a toxic waste dump on an agar plate and pick a single bacterium from which you prepare DNA. The
isolated organism is a new, previously uncharacterized species. You perform PCR amplification of this DNA using primers to amplify a
short segment of ribosomal DNA. When you use BLAST to find similar sequences, you find the following results.
Organism
E. coli
Streptococcus
Burkhoderia
Microbacterium oxydans
DNA sequence identity. % sequence E-value
coverage
e-10
E. coli
84%
88%
98%
100%
40%
40%
40%
80%
e-12
e-15
e-30
Based on the data in the table, which species is most closely related to your toxic waste dump sample?
Microbacterium oxydans
Streptococcus
Burkhoderia
A urine sample has been obtained, and the bacteria in this sample were cultured.
To obtain more information regarding the identity of this Gram-negative strain, Sanger sequencing can be used. A bacterial colony is transferred into a 0.2 mL tube containing buffer, then boiled to break open the bacterial cells. The tube is centrifuged, and some of the supernatant is transferred to a PCR tube. Next, the following reagents are added: DNA polymerase, a primer that binds near the 16S rRNA region of the bacterial chromosome, dNTPs, and fluorescently-labeled ddNTPs. The sequencing reaction is processed in a thermocycler, then analyzed by capillary electrophoresis. This experiment generates the following results (in FASTA format):
> sequencing results TAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATG TCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATAC CGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGA TGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACG…
Chapter 13 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 13.1 - What characteristics would have made the surface...Ch. 13.1 - How do we know when oceans were first present on...Ch. 13.1 - What lines of reasoning support the hypothesis...Ch. 13.1 - What is LUCA, and what is a plausible explanation...Ch. 13.2 - Why is the origin of cyanobacteria considered a...Ch. 13.2 - What caused the development of banded iron...Ch. 13.2 - What lines of evidence indicate that microbial...Ch. 13.2 - Why was the origin of cyanobacteria of such...Ch. 13.3 - What kinds of evidence support the three-domain...Ch. 13.3 - What is LUCA and what are some of its...
Ch. 13.3 - Which of the three domains is the least ancient?Ch. 13.3 - What evidence supports the classification of life...Ch. 13.4 - What evidence supports the idea that the...Ch. 13.4 - In what ways are modern eukaryotes a combination...Ch. 13.4 - Describe the different hypotheses for the...Ch. 13.4 - What is the endosymbiotic hypothesis for the...Ch. 13.5 - What are the different processes that give rise to...Ch. 13.5 - What is the difference between selection and...Ch. 13.5 - In the experiment of Figure 13.12, why did the...Ch. 13.5 - What is fitness? To what degree does fitness...Ch. 13.6 - What is the difference between the core and pan...Ch. 13.6 - What kind of recombination might have the greatest...Ch. 13.6 - What effects do deletions have on the evolution of...Ch. 13.6 - What are some processes that influence the content...Ch. 13.7 - How are DNA sequences obtained for phylogenetic...Ch. 13.7 - What does a phylogenetic tree depict?Ch. 13.7 - Prob. 3MQCh. 13.7 - What is the difference between a gene tree and an...Ch. 13.8 - What is the difference between taxonomy and...Ch. 13.8 - What are some key criteria from the phylogenetic...Ch. 13.8 - How many species of Bacteria and Archaea have been...Ch. 13.8 - What is the "species problem" and why is the...Ch. 13.9 - What class of genes is used in MLST analyses?Ch. 13.9 - How is ribotyping different from rep-PCR?Ch. 13.9 - What is FAME analysis?Ch. 13.9 - Prob. 1CRCh. 13.10 - What roles do culture collections play in...Ch. 13.10 - What is the IJSEM and what taxonomic function does...Ch. 13.10 - Why might viable cell cultures be of more use in...Ch. 13.10 - Prob. 1CRCh. 13 - Compare and contrast the physical and chemical...Ch. 13 - For the following sequences, construct the...Ch. 13 - Imagine that you have been given several bacterial...Ch. 13 - Imagine that you have discovered a new form of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Someone broke into the bookstore and stole thousands of dollars’ worth of textbooks. Some hairs were left behind, from which DNA was extracted. An individual was caught with all five of the stolen textbooks in his bag. He claims his friend gave them to him. You decide to amplify two regions of the DNA (two loci, plural of locus) and digest the samples, and get the following result on the electrophoresis gel.L = Standard marker 1 = Suspect 1 2 = Suspect 2 3 = DNA from crime scene (Note: assume bands that are close in distance traveled are the same length. Higher concentrations of DNA can make a band appear to travel farther.) Which band patterns are similar?arrow_forwardSomeone broke into the bookstore and stole thousands of dollars’ worth of textbooks. Some hairs were left behind, from which DNA was extracted. An individual was caught with all five of the stolen textbooks in his bag. He claims his friend gave them to him. You decide to amplify two regions of the DNA (two loci, plural of locus) and digest the samples, and get the following result on the electrophoresis gel.L = Standard marker 1 = Suspect 1 2 = Suspect 2 3 = DNA from crime scene (Note: assume bands that are close in distance traveled are the same length. Higher concentrations of DNA can make a band appear to travel farther.) Who is most likely the culprit, and how do you know?arrow_forwardIn DNA-DNA Hybridization, sequences from two separate organisms that show partial hybridization suggest _______. a) They are related b) suggest they are not related c)suggest that they are the same organismarrow_forward
- DNA from a strain of Bacillus subtilis with genotype a* b* c* d* e* is used to transform a strain with genotype a b c d e. Pairs of genes are checked for cotransformation, and the following results are obtained: Pair of genes Cotransformation Pair of genes Cotransformatic a* and b* No b* and d* No a* and c* No b* and e* Yes a* and d* Yes c* and d* No a* and e* Yes c* and e* Yes b* and c* Yes d* and e* No On the basis of these results, what is the order of the genes on the bacterial chromosome?arrow_forwardIn figure 10.16 , how would the curve appear if the GC content of the DNA sample were increased? How would the curve appear if the AT content were increased?arrow_forwardb ) Describe the contribution of Griffith , Avery et al . , Hershey & Chase , and Watson and Crick in the field of genetics . You are characterizing a newly discovered organism . You have noticed that the organism grows on two carbon sources - sucrose and mannitol . Whenever you add both sugars to the medium , sucrose will be completely metabolized before mannitol . a ) What is this growth pattern called ? b ) Describe a possible growth curve of sequential metabolism of the sugars . arrow_forward
- DNA from a strain of Bacillus subtilis with genotype a+ b+ c+ d+ e+ is used to transform a strain with genotype a− b− c− d− e−. Pairs of genes are checked for cotransformation, and the following results are obtained: Pair of genes Cotransformation Pair of genes Cotransformation a+ and b+ No b+ and d+ No a+ and c+ No b+ and e+ Yes a+ and d+ Yes c+ and d+ No a+ and e+ Yes c+ and e+ Yes b+ and c+ Yes d+ and e+ No On the basis of these results, what is the order of the genes on the bacterial chromosome?arrow_forward1.) What characteristics of VNTR and STR make them useful for DNA fingerprinting? 2.) How does PCR minimize the problems associated with degraded DNA? 3.) What factors can cause DNA to become degraded? 4.) If Ethidium bromide was not added to a gel, what would happen? 5.) How can you tell if an individual is heterozygous for the D1S80 marker? 6.) If a negative control produces a band, what does this indicate? 7.) In an experiment, a student’s sample amplified for D1S80 produced 3 bands. It was the only DNA sample run on the gel. The student knows that there was no problem with the Thermocycler or primers because the other students in the class had the expected results of only one or two bands. What is the most likely explanation for these results?arrow_forwardPlease answer these two questions regarding PCR: a) Why do you need to perform PCR on DNA obtained from a crime scene? b) Why so forensic labs analyze non-coding DNA rather than genes?arrow_forward
- Streptococci are divided into different groups called serotypes. Consult this or other textbooks and explain what determines the different serotypes (A-O) of streptococci?arrow_forwardEscherichia coli (E. coli) is a bacterium normally found in the human gut. It is harmless and may actually be beneficial to the human digestive system. There is a pathogenic strain of E. coli that produces a toxin that can kill its human host. The two strains look very similar under the microscope. Comparison of their genomes reveals that the pathogenic strain lacks 528 genes found in the normal strain and has 1,387 genes not found in the not found in the normal strain. Are the normal and pathogenic strains of E.coli separate species? Explain your answer.arrow_forwardIn another experiment, Griffith mixed heat killed S strain with live R strain bacteria and injected the mixture into mice. A. What strain of the bacteria was found in the blood samples of the mice? B. What were the results of this experiment? C. What conclusion did he reach based on these results?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
8C - How to do genetic analysis; Author: Useful Genetics;https://www.youtube.com/watch?v=HIa7nPyGn4s;License: CC-BY