Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 11, Problem 19PDQ
Summary Introduction
To review:
The distribution of nucleosome on the newly synthesized chromatin.
Introduction:
Chromatin is a complex of DNA (deoxyribonucleic acid) and proteins in the eukaryotic cells that forms the chromosome. The packaging of the chromatin thread into the chromosome is done by a nucleosome. The nucleosome is the basic unit of packaging consisting of DNA molecules wrapped around the histone proteins to form a condensed structure of the genome.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
During the resolution of the two Holliday junctions, how many strands of DNA in total are broken during this process? Does the number differ depending on if this leads to recombination or non-recombination?”
Why is DNA replication is considered a semi-discontinuous process? Explain in detail.
Considering prokaryotes, what term adds nucleotides in the 5' to 3' direction during DNA replication?
Chapter 11 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 11 - CASE STUDY | Art inspires learning A genetics...Ch. 11 - Prob. 2CSCh. 11 - Prob. 3CSCh. 11 -
HOW DO WE KNOW?
1. In this chapter, we focused on...Ch. 11 - Review the Chapter Concepts list on p. 199. These...Ch. 11 - Prob. 3PDQCh. 11 - Describe how giant polytene chromosomes are...Ch. 11 - What genetic process is occurring in a puff of a...Ch. 11 - Prob. 6PDQCh. 11 - Why might we predict that the organization of...
Ch. 11 -
8. Describe the sequence of research findings...Ch. 11 - Prob. 9PDQCh. 11 - Prob. 10PDQCh. 11 - Provide a comprehensive definition of...Ch. 11 - Prob. 12PDQCh. 11 - Define satellite DNA. Describe where it is found...Ch. 11 - Prob. 14PDQCh. 11 -
15. Mammals contain a diploid genome consisting...Ch. 11 - Prob. 16PDQCh. 11 - Prob. 17PDQCh. 11 - Prob. 18PDQCh. 11 - Prob. 19PDQCh. 11 - The human genome contains approximately 106 copies...Ch. 11 - Prob. 21PDQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardOxidative deamination of adenine produces hypoxanthine (the base of inosine), which can base pair with cytosine. (a) If no repair takes place, describe the makeup of the DNA in the two daughter cells following cell division. (b) Describe the makeup of the DNA in the four daughter cells following a second round of cell division.arrow_forwardIn relation to central dogma of molecular biology answer the following questions: A- Give two reasons why the DNA replication is asymmetrical process (i.e. the DNA replication outcome is different between the leading and lagging strands)? B-The following segment of DNA is part of the transcription unit of a gene. You know already that RNA polymerase moves in a specific direction along this piece of DNA to convert one of the DNA strands into a single strand RNA transcript so that this entire region of DNA is made into RNA. 5′-GGCATGGCAATATTGTAGTA-3′ 3′-CCGTACCGTTATAACATCAT-5′ Given this information, a student claims that the RNA produced from this DNA is: 3′-GGCATGGCAATATTGTAGTA-5′ Give two reasons why this answer is incorrect. C- Imagine that the mRNA codons consisted of only two nucleotides instead of three nucleotides. Would there be a sufficient number of codons for all twenty amino acids? Explain your answer. D- The length of a particular gene in human DNA,…arrow_forward
- Below is a diagram of DNA replication as currently believed to occur in E. coli. From specific points, arrows are provided that lead to numbers. Answer the questions below relating to the locations specified by the numbers. (02) What end (5’ or 3’) of the molecule is here? (State which) What enzyme is probably functioning here to deal with supercoils in the DNA? What enzyme is probably functioning here to unwind the DNA? What nucleic acid is probably depicted here? What are these short DNA fragments usually called? What enzyme probably functions here to couple these two newly synthesized fragments of DNA? Is this strand the leading or lagging strand? What end (5’ or 3’) of the molecule is here? (State which)arrow_forwardDescribe the packaging of chromosomal DNA by histones with diagrammatic representations. Name the various histone modifications and describe any two among them.arrow_forwardThe regulation of replication is essential to genomic stability. Normally, the DNA is replicated just once in every eukaryotic cell cycle (in the S phase). Normal cells produce protein A, which increases in concentration in the S phase. In cells that have a mutated copy of the gene encoding protein A, the protein is not functional, and replication takes place continuously throughout the cell cycle, with the result that cells may have 50 times the normal amount of DNA. Protein B is normally present in G1, but disappears from the cell nucleus during the S phase. In cells with a mutated copy of the gene encoding protein A, the levels of protein B fail to drop in the S phase and, instead, remain high throughout the cell cycle. When the gene for protein B is mutated, noreplication takes place. Propose a mechanism for how protein A and protein B might normally regulate replication so that each cell gets the proper amount of DNA. Explain how mutation of these genes produces the effects just…arrow_forward
- Explain why telomeres and telomerase are needed for replication of eukaryotic chromosomes but not bacterial chromosomes.arrow_forwardIf the DNA of chromosome 1 is fully extended, it will exceed the diameter of the nucleus of a cell by about 15,000 times. Therefore, discuss how DNA is packaged into the cell.arrow_forwardExplain why DNA replication proceeds only in the 5′ to 3′direction.arrow_forward
- Which of the followings statements are true about DNA polymerase? 1.) It can only go in one direction, meaning the lagging strand can't be synthesized continuously. 2.) It cannot start a DNA strand from scratch, so another enzyme is needed to create "primers" as a starting point. 3.) It cannot copy epigenetic marks (such as methyl groups) on its own; these must be "copied" onto the daughter DNA strand by other enzymes after DNA replication. 4.) All of the abovearrow_forwardWith regard to DNA replication, define the term bidirectional replication.arrow_forwardSince eukaryotic chromosomes are assembled with histone proteins, how are replication and transcription carried out? Describe the mechanisms.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
The Cell Cycle and its Regulation; Author: Professor Dave Explains;https://www.youtube.com/watch?v=eqJqhA8HSJ0;License: Standard YouTube License, CC-BY
Cell Division - Mitosis and Meiosis - GCSE Biology (9-1); Author: Mr Exham Biology;https://www.youtube.com/watch?v=w7vp_uRA8kw;License: Standard YouTube License, CC-BY