Below is a diagram of DNA replication as currently believed to occur in E. coli. From specific points, arrows are provided that lead to numbers.   Answer the questions below relating to the locations specified by the numbers.                                                                              (02)  What end (5’ or 3’) of the molecule is here? (State which) What enzyme is probably functioning here to deal with supercoils in the DNA? What enzyme is probably functioning here to unwind the DNA? What nucleic acid is probably depicted here? What are these short DNA fragments usually called? What enzyme probably functions here to couple these two newly synthesized fragments of DNA? Is this strand the leading or lagging strand? What end (5’ or 3’) of the molecule is here? (State which)

Hydrolysis of the N-glycosyl bond between deoxyribose and a purine base in DNA creates an apurinic (AP) site. An AP site is more thermodynamically destabilizing to a DNA molecule than is a mismatched base pair. Examine the structure of an AP site. H₂N HN N O™ -O-P-O-CH₂ Guanine H₂N N HN Select the chemical consequences that could contribute to DNA instability at AP sites. H H 1₂0/ H fewer hydrogen bonds between the unpaired pyrimidine base and water disruption of the base-stacking interactions decreased interaction between the mutated DNA strand and histones increased ability of the deoxyribose ring to open without the attachment of the purine base H H Guanosine residue (in DNA) O™ -O-P-O-CH₂ O H H H O Apurinic residue H OH H

In NOT more than 200 words, explain how the double-helical structure of DNA suggests a mechanism for DNA replication?

There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA replication. a) Please replicate the parental strands into two exact copies TC GATATCGG AGCTATAGCC b) place a centromere between the two replicated copies (or tell me where the centromere would be located),

As you should recall, DNA, when not being actively transcribed, has a double helical structure.  This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein.  The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template   strand?  ______________________________ Q:  Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA:      ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain:  ________--________--________--________--________--________--________--________

Using the illustration of DNA replication given below label the following:

You are studying a colony of cells and determine that some of these cells have a mutated DNA polymerase I that results in loss of function of this enzyme. A)   What will the effect of the mutation in DNA polymerase I be on DNA replication? In your answer make sure to describe what would be observed in the leading and lagging strand and explain your reasoning.  B)   Will this mutation in DNA polymerase I have an impact on another step in DNA replication? In your answer make sure to indicate whether DNA replication will be impacted or not. If it is not, explain why. If it is impacted, then describe the step that is impacted and name the molecule or enzyme involved.

Cytosine can be deaminated to form Uracil   What type of mutation is this classified as? Discuss what happens to the base-pairing properties from switching from C to U? When U is replicated in two rounds of synthesis, what substitution does this result in? Before Uracil alters the DNA during replication, what repair system can be used to correct this error? Describe how this type of DNA repair works?

DNA replication is vital for successful cell division. Explain the process of DNA replication. Make sure to use the following terms: helicase, S-phase, DNA polymerase and DNA ligase, template, free nucleotides. Use the diagram if it helps you illustrate your points.

Describe the process of DNA replication as if explaining it to a fellow classmate. Imagine there is an unlabelled diagram in front of you to guide your explanation. (Try to include as many relevant proteins and concepts as possible to help demonstrate an understanding, eg. DNA Helicase, Okazaki Fragments, etc).