The effect of a mutation in an allosteric enzyme that resulted in a T/R ratio of 0 is to be stated. Concept introduction: Enzymes being the catalysts increase the rate of reaction . In an enzyme-catalyzed reaction, the rate of reaction for the product formation depends on the concentration of enzyme as well as the substrate involved in the reaction via formation of an enzyme substrate complex.The enzyme which is able to do the conformational changes if an effector gets attached to it is known as allosteric enzyme.

Question

Want to see the full answer?

Answer 1

Question

Chapter 10, Problem 7P

Interpretation Introduction

Interpretation:

The effect of a mutation in an allosteric enzyme that resulted in a T/R ratio of 0 is to be stated.

Concept introduction:

Enzymes being the catalysts increase the rate of reaction. In an enzyme-catalyzed reaction, the rate of reaction for the product formation depends on the concentration of enzyme as well as the substrate involved in the reaction via formation of an enzyme substrate complex.The enzyme which is able to do the conformational changes if an effector gets attached to it is known as allosteric enzyme.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

. Geneticists interested in human hemoglobins havefound a very large number of mutant forms. Some ofthese mutant proteins are of normal size (but haveamino acid substitutions) while others are short, dueto deletions or nonsense mutations. The first extralong example was named Hb Constant Spring, inwhich the β-globin has all of its normal amino acidsplus several extra amino acids attached after thenormal C-terminal end of the protein. a. What is the most plausible explanation forits origin?b. Is it possible that Hb Constant Spring arose fromfailure to splice out an intron?c. Estimate how many extra amino acids mightbe added to the C terminal end of the mutantprotein

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.

Homozygosity for extremely rare mutations in a humangene called SCN9A cause complete insensitivity topain (congenital pain insensitivity or CPA) and a totallack of the sense of smell (anosmia). The SCN9A geneencodes a sodium channel protein required for transmission of electrical signals from particular nerves inthe body to the brain. The failure to feel pain is a dangerous condition as people cannot sense injuries.The SCN9A gene has 26 exons and encodes a1977-amino acid polypeptide. Consanguineous matings in three different families have resulted in individuals with CPA/anosmia. In Family 1, a G-to-Atransition in exon 15 results in a truncated protein that is898 amino acids long; in Family 2, deletion of a singlebase results in a 766-amino acid polypeptide; and inFamily 3, a C-to-G transversion in exon 10 yields a458-amino acid protein.a. Hypothesize as to how each of the three SCN9Amutations affects gene structure: Why are truncatedproteins made in each case? b. How would you…