Biology: Science for Life with Physiology (6th Edition) (Belk, Border & Maier, The Biology: Science for Life Series, 5th Edition)
Biology: Science for Life with Physiology (6th Edition) (Belk, Border & Maier, The Biology: Science for Life Series, 5th Edition)
6th Edition
ISBN: 9780134555430
Author: Colleen Belk, Virginia Borden Maier
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 10, Problem 3AAATB
Summary Introduction

To write:

The site at which the restriction enzymes cuts the DNA.

Introduction:

Genome is defined as the complete genetic material that is present in an organism. It consists of the coding as well as the non-coding parts of DNA. The study of the genome is termed as genomics. Restriction enzymes are widely used enzymes in the field of genomics. This enzyme was discovered by three scientists named “Werner Arber, Hamilton Smith, and Daniel Nathans”.

Blurred answer
Students have asked these similar questions
The partial sequence of one strand of a double-stranded DNA molecule is 5'-GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG -3' EcoRI is a restriction enzyme that cleaves after G in the sequence 5'-GAATTC-3'. PstI is a restriction enzyme that cleaves after A in the sequence 5'-CTGCAG-3'. Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The first strand of your duplex DNA fragment should be derived from the given strand sequence. 5'- -3' 3'- -5'
The double stranded DNA sequence shown contains the promoter for the transcription of a bacterial gene. GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA CCGTGGACGCTACGTACTTATATAGCTAGCCCTTAGCGATACAGTTCGGTACCGATCTAAT Draw a box around each of the promoter elements and identify each. Identify which strand will be used as the template strand by putting a vertical line between the -1/+1 start site nucleotides and underlining in the direction of transcription on the template strand as the example below indicates. ATCGG\GAATCGC TAGCCCTTAGCG Give the sequence of the RNA created
For a restriction enzyme that recognizes the restriction site GGCC, Which of the following statements is/are true?
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY