CAMPBEL BIOLOGY:CONCEPTS & CONNECTIONS
10th Edition
ISBN: 9780136538820
Author: Taylor
Publisher: INTER PEAR
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 10TYK
The base sequence of the gene coding for a short polypeptide is CTACGCTAGGCGATTGACT. What would be the base sequence of the mRNA transcribed from this gene? Using the genetic code in Figure 10.8A, give the amino acid sequence of the polypeptide translated from this mRNA. (Hint: What is the start codon?)
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What would be the base sequence of the mRNA transcribed from this gene?
The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. From your answer to the last question, answer this
Using the genetic code, give the amino acid sequence of the polypeptide translated from this mRNA.
Use the three-letter abbrebviation of the amino acid and start with the start codon and stop in the stop codon.
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine.
5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
Refer to the information on the genetic
code. Use this information to determine
how many amino acids are coded for by
the mRNA sequence
AUGCGCAGUCGGUAG.
The genetic code
Second letter of codon
UAU
UAC
JUU Phenylalanine uCU
UUC Phe)
UUA Leucine (Leu)
UUG
Tyrosine (Tyr)
GCysteine (Cys)
UGC
1oStop codon
|UGG Tryptophan (Trp)
CGU
CGC
UcC
Serine (Ser)
UCA
ucc
CCU
cC Proline (Pro)
Stop codon
UAG Stop codon
CAU
Histidine His)
CU
CUC
CUA
CUG
Arginine (Arg)
Leucine (Leu)
cca
CAA
CCA
CGA
Glutamine (Gin)
CAG
AUU
AUC
AUA
ACU
Isoleucine (le)
AAU
AAC
AGU
AGC
Asparagine (Asn)
Serine (Ser)
ACC
Threonine (Thr)
ACA
Methicnine
ACC
start codon
GCU
Lysine (Lys)
AGA
Arginine (Arg)
ARC
AGS
GAU Aspartic acid (Asp)G0
GAC
GUU
GUC Valine (Val)
GCC Alanine (Ab)
GG Glycine (Gly
GUA
GUG
GCA
GCG
GA Glutamic acid (Glu) GA
GGG
GAG
4
15
First letter of codon
Third letter of codon
Chapter 10 Solutions
CAMPBEL BIOLOGY:CONCEPTS & CONNECTIONS
Ch. 10 - Check your understanding of the flow of genetic...Ch. 10 - Which of the following correctly ranks the...Ch. 10 - Describe the process of DNA replication: the...Ch. 10 - What is the name of the process that produces RNA...Ch. 10 - Scientists have discovered how to put together a...Ch. 10 - A geneticist found that a particular mutation had...Ch. 10 - Describe the process by which the information in a...Ch. 10 - The nucleotide sequence of a DNA codon is GTA. A...Ch. 10 - A cell containing a single chromosome is placed in...Ch. 10 - The base sequence of the gene coding for a short...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A Garrow_forwardThe base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence State the amino acid sequence of the polypeptide translated from this mRNA Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.arrow_forwardWhat is the total size of the mature i.e. fully processed mRNA in nucleotides? How many amino acids would the encoded protein be? Assume that the N- terminal Met encoded by the AUG start codon, is NOT cleaved from the protein?arrow_forward
- The following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.arrow_forwardOn the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5’cap is indicated by (5’). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5’)CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA(3’) In a previous round of replication, DNA polymerase made a mistake and added a C on what is now the DNA template strand. In the space on the mRNA sequence below, write the added base. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5’)CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3’arrow_forwardIf the mRNA transcribed for this gene will be translated into a functional protein, how many amino acids will be used to build the polypeptide chain? what is the amino acid coded by the 25th codon? what is the amino acid coded by the last codon?arrow_forward
- What is the sequence of the mRNA molecule synthesized from the DNA template strand 5'-TAACGGTACGAT-3'? Enter the mRNA sequence using the one-letter abbreviations for the nucleotides. 5'- UAACGGUACGAU What amino acid sequence is encoded by the mRNA molecule 5'-AACGGAUCACUAACCUAC-3'? Assume that the reading frame starts at the 5′ end. Use a codon table to determine the identity of the translated peptide. Enter the amino acid sequence using three-letter abbreviations for the amino acids separated by hyphens (-). N-terminus Asn-Gly-ser-Leu-Thr-Tyr What is the sequence of the polypeptide formed if poly(UUAC) is added to a cell-free, protein-synthesizing system? poly(His-Ser-Phe-Ile) Asn-Glu-stop poly(Leu) Val-Ser-Lys-stop poly(Tyr) -3' poly(Leu-Leu-Thr-Tyr) C-terminusarrow_forwardConsider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.arrow_forwardAssume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'arrow_forward
- Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUarrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardAn mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY