Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 1, Problem 6P
RNA shares with proteins the ability to fold into complex three-dimensional shapes. As a result, RNA molecules can, like protein molecules, catalyze biochemical reactions (that is, both kinds of molecules can act as enzymes, or biological catalysts). These statements are not true of DNA. Why can some RNA molecules act as enzymes whereas DNA molecules cannot? (Hint: Most RNA molecules consist of a single strand of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Select TRUE or FALSE for each of the following statements:
1. Only one of the three phosphate groups present in each nucleotide precursor remains present in a DNA polymer.
2. Starch and cellulose are alike in that both contain sugars bonded together in identical ways.
3. The coding strand of DNA is complementary in sequence to the corresponding MRNA.
4. Ribosomal RNA (rRNA) is synthesised by ribosomes in the process of translation.
5. Polyribosomes speed up the rate of transcription.
Hydrolysis of the N-glycosyl bond between deoxyribose and a
purine base in DNA creates an apurinic (AP) site. An AP site is
more thermodynamically destabilizing to a DNA molecule
than is a mismatched base pair.
Examine the structure of an AP site.
HN
H₂N N
0
Guanine
-O-P-O-CH₂O.
H₂N
H
HN
H
H H
Hod
H
ofo
-0-
Guanosine residue
(in DNA)
-0-CH₂
H
H H
Apurinic residue
H
OH
H
What are the complementary base pairs in DNA-RNA interactions? Answer format: Base 1(one letter symbol)-Base 2 (one letter symbol, or B-B*(hypothetical N-base)
In the lengthening of a polynucleotide chain, which type of nucleotide subunit (name please not the formula) would bond to its 3’ end?
How many 3’,5’-phosphodiester linkages are present in a tetranucleotide segment of a nucleic acid?
Chapter 1 Solutions
Genetics: From Genes to Genomes
Ch. 1 - Choose the phrase from the right column that best...Ch. 1 - If one strand of a DNA molecule has the base...Ch. 1 - The size of one copy of the human genome is...Ch. 1 - Indicate whether each of the following words or...Ch. 1 - a. How many different DNA strands composed of 100...Ch. 1 - RNA shares with proteins the ability to fold into...Ch. 1 - The human protein lactate dehydrogenase shown in...Ch. 1 - a. Are the triplets in the genetic code table...Ch. 1 - Why do scientists think that all forms of life on...Ch. 1 - Why would a geneticist study a yeast cell or a...
Ch. 1 - How can a scientist tell if a protein present in...Ch. 1 - Figure 1.6 shows the amino acid sequences of parts...Ch. 1 - Why do scientists think that new genes arise by...Ch. 1 - Explain how the exon/intron structure of genes...Ch. 1 - Mutations in genes that change their pattern of...Ch. 1 - A single zebrafish gene function was inactivated...Ch. 1 - Different mutations in the WDR62 gene that...Ch. 1 - Researchers have successfully used gene therapy to...Ch. 1 - By the time this book is published, it will likely...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Hairpins may form at palindromic sequences in single strands of either RNA or DNA. How is the helical structure of a long and fully base-paired (except at the end) hairpin in RNA different from that of a similar hairpin in DNA?arrow_forwardThese are (necessarily) present in nucleotides, but NOT in nucleosides. These are present in RNA molecules that have secondary structure, but absent in RNAS that lack it. 1. Hydrogen bonds 2. N-glycosidic bonds These account for the "base stacking" interactions that help to stabilize DNA 3. Phosphodiester bonds structure. 4. Phosphoester bonds These are transiently broken and then reformed 5. Van der Waals forces by topoisomerases. These are (necessarily) present in BOTH nucleosides and nucleotides. >arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forward
- Describe the functions of the following proteins during DNA breaks and repair: (i) Ku70 (ii) Uracil DNA glycosylasearrow_forwardWhat are the three components of a nucleotide?arrow_forward2) When DNA is placed in distilled water, which is pH 7.0, it denatures (i.e., the two strands separate). The pH inside a cell is generally 7.2-7.5, depending on the organism, but DNA is generally double-stranded under physiological conditions. Briefly explain, in your own words, why DNA denatures when placed in distilled water but not when it is inside a cell. [Reminder: the pKa for the phosphate groups in the sugar-phosphate backbone of a strand of DNA is 2.14]arrow_forward
- Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?arrow_forwardWould you expect the double helix in a short segment of DNA to be more stable in a storage solution of sodium phosphate buffer at pH 7.0 or in pure water? Why? pure water; because any cations in the storage solution would prevent complementary bases from forming ionic interactions sodium phosphate buffer at pH 7.0; because a neutral pH is required to maintain the covalent bonds between complementary bases O pure water; because the high dielectric constant of water is sufficient to stabilize the covalent bonds between deoxyriboses in the DNA backbone sodium phosphate buffer at pH 7.0; because the presence of water and sodium neutralizes the charge of phosphate groups in the DNA backbonearrow_forwardThere are different types of helical structures that can be found in proteins (i.e., not only helices). What is common among different types of helices is that the he structure is maintained by intrachain hydrogen bonding between two polypeptide backbone atoms. Oftentimes, at least two intrachain hydrogen bonds need to be formed in order for a helix to start gaining stability. This can be observed from circular dichroism, technique that detects helicity in proteins. Circular dichroism starts detecting helicity in a helical chain only when there are at least two intrachain hydrogen bond formed. If a helical structure is too short such that it only has one intrachain hydrogen bond, the helix is too unstable for the helicity to be accurately detected th circular dichroism. Four different types of helical structures were studied using circular dichroism and the minimum number of residues needed for helicity to become detectable wa determined as summarized in the table below. Minimum number…arrow_forward
- RNA nucleotides can undergo versatile base pairing. What does this mean, and what is the consequence for the structure of RNA? Please help simplify/explain this in 5 sentences or lessarrow_forwardState the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixarrow_forwardChemical analysis shows that a nucleic acid sample contains A, U, C, and G. Is this DNA or RNA? Why?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license