You would like to use a CRISPR-Cas system to knockout a gene that includes the following sequence: 5'-CATACGAGCGACGACGCATTACGTGGACGTATACACTACATA-3' 3'-GTATGCTCGCTGCTGCGTAATGCACCTGCATATGTGATGTAT-5' You have designed a guide RNA sequence with the sequence 5'- UACGAGCGACGACGCAUUACG-3' to work with a Cas9 protein to edit this sequence. List the sequence of a three nucleotide Protospacer Adjacent Motif (PAM) that you will need to include in the guide RNA that can be used by this particular CRISPR-associated protein? Note: the sequence will be different from the PAM sequence that we were working with in the CRISPR lab because we are using Cas proteins from other bacteria.

would see If you were to look at other CRISPR'd mutants with 1-2 nt deletions, the position of the 1-2 base deletion relative to the PAM sequence is fairly constant. Why is this? F. you ADE3 mutants Query 60 ТААTGAAATСААААGCATТСАAGGTCACGTGCCTGGGТTTGCАCСТААССТТGCCAТСАТТСАAGTAGGCAACAGAC 138 Query_52371 1 1 88 Query_52369 Query_52367 1 88 88 Query_52366 Query_52365 1 88 ..... 88 Query_52363 88

Great! Now you have the gene sequence. Now you would like to clone it into an expression vector to grow up in a bacterial system. Because you're going to use bacteria to generate protein from a eukaryote, the mammoth, you need to get rid of introns from your sequence. How do you do that? O Bioinformatically, I look for splice-site sequences and branch-point adenines and predict intron-exon boundaries O l use a comparative genomic approach and use sequence homology with the genome of a closely related species O luse a comparative genomic approach and use sequence homology with the genome of a distantly related species O Both A and B O Both B and C

Ali sequenced a plant protein. He is not a bioinformatician and is actually scared of computers. Yet, he would like to know what the structure might look like to do some rounds of rational mutagenesis. I told him I would collect a group of bioinformaticians to solve this problem. Please don't disappoint him.  He came up with this sequence:   SVCCPSLVARTNYNVCRLPGTEAALCATFTGCIIIPGATCGGDYAN Find the template? Use swiss model to build the structure?

What type of RNA is involved in the post-transcriptional modification illustrated below? 5' in m 3' 5' 3' 5' AAAAGGGCUUUAACUUCA 9 AAAAGGGCUUUAACUUCA UUUUUUUGAAAUUGAAGU AAA AAAA A AAAUUUAUGUGUUGUCUUUUAACUUCA UUUAAAUAUAUAAUAGAAAAUUGAAGU AAAUUUAUGUGUUGUCUUUUAACUUCA 3' 3' 5' 3' 5' 3'

In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’

In a clinical context, a scientist is working with a viral DNA which is about 24000bps long. There are two known variants of the virus that share almost the same DNA but for a final fragment; with reference to Figure Q2b, the regions A and B are conserved in both variants, while the region C differs and is either 320bps (variant 1) or 380bps (variant 2). The scientist wants to set up a procedure to identify the variant they are dealing with. Viral dsDNA (i) (ii) (iii) Stable region (A) Variable region (C) Figure Q2b Known sequence (B) 5-GACCTCAATGTCCAGCGGTACGCTCATAAA-3' 3'-CTGGAGTTACAGGTCGCCATGCGAGTATTT-5' The scientists want to design a primer to amplify the variable region and to do so, they sequence a small fragment (sequence B) the conserved region close to the variable region C. Why is the scientist targeting a region outside of the fragment of interest? [3] The sequence of the fragment B is reported in Figure Q2b. Suggest a primer that can efficiently target this region and…

Suppose a researcher previously cloned gene Y into M13 bacteriophage vector. Gene Y encodes a product called peptide Y. A region of gene Y contains the DNA sequence ATG-CGC-GAA-CTG-GTG-AAC-TAA. The researcher wishes to change a Val residue to an Ala residue in this region of peptide Y using site-directed mutagenesis. What should be the sequence of the mutant oligonucleotide primer in this region? You may use a codon table. mutant oligonucleotide primer sequence: GGC-GGC-GAA-CTG-GTG-AAC-TAA Incorrect

You have recently cloned multiple cDNAs for a gene you are studying. After sequencing ten of the cDNAs, you find that seven of the cDNAs would produce a protein of 531 amino acids, while the other three cDNAs would produce a protein missing 30 amino acids from the center of the protein. This finding is can be explained by: O nonsense suppression O alternative splicing O basepair wobble O variability in the length of the poly(A) tail

Imagine that a colleague asks you to align a conserved spike protein-coding gene sequence from SARS-CoV2 virus (Severe acute respiratory syndrome-related coronavirus variant 2) to its homolog (i.e., equivalent spike protein-coding gene sequence) in the MERS virus (Middle East respiratory syndrome-related coronavirus). Which sequence type - nucleic acid (DNA or RNA), or protein - would you expect to exhibit the highest percentage of identities? Why?