Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 2 steps
Knowledge Booster
Similar questions
- 1a.The complete genotype of the host yeast strain is MATa ade2 his3 leu2 met15 ura3. Name one advantage of using a yeast strain with auxotrophies for several genes (i.e. his3, leu2 and ura3). b.)After successful CRIPSR editing, the yeast can later be “cured” of the recombinant CRISPR plasmid – that is, the plasmid is lost but the CRISPR edit is stably inherited. Write the new genotype of the yeast based on ADE6 gene.arrow_forwardCRISPR-cas9 is a powerful technique for gene editing. Please place the stages of a CRISPR-cas9 gene editing workflow in the correct order below options are on the rightarrow_forwardPrimers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAAarrow_forward
- what is the function and origin of this DNA sequence (use BLAST and NEBcutter)? ATGGCAAACCCGGAACAACTGGAAGAACAGCGTGAAGAAACACGTTTGATTATTGAAGAATTACTGGAAG ATGGCAGCGATCCGGACGCGCTGTACACCATCGAACACCATCTTTCCGCAGACGATCTGGAAACCCTGGA AAAAGCAGCAGTTGAAGCGTTTAAACTCGGTTACGAAGTGACCGATCCAGAAGAGCTGGAAGTTGAAGAT GGTGATATCGTGATTTGCTGCGACATCCTCAGCGAGTGCGCGTTGAATGCCGATCTGATCGATGCCCAGG TTGAACAACTGATGACGCTGGCAGAGAAATTTGACGTTGAGTACGACGGATGGGGCACTTACTTTGAAGA TCCTAACGGCGAAGATGGCGACGATGAAGATTTTGTCGATGAAGACGATGACGGAGTTCGCCACTAAarrow_forwardthe topic is Identification of Differentially Expressed Genes in Breast Cancer Using RNA-Seq write a method section of a scientific report for this topic. including the use of excel to get these result( will be included in the images) and also this website https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE216238arrow_forwardThe image below shows the general structure of a gene on a chromosome. The arrows above and below the chromosome indicate the binding positions of potential forward (F) and reverse (R) PCR primers. Select two primers from the list below that would exclusively amplify exon 3 in a PCR reaction. ut of Intron 1 Intron 2 +1 Poly-A signal ATG TAG F1 Exon 1 F4 Exon 2 F6 Exon 3 R6 R4 R3 R2 R1 Promoter Select all that apply: cross out Da. F1 cross out Ob. F2 cross out Oc. F3 cross out O d. F4 cross out O e. F5 cross out f. F6 cross out g. R1 cross out Oh. R2 cross out OL R3 cross out O. R4 cross out k. R5 cross out R6 TIarrow_forward
- ● Gene lacZ fliE Please fill in the table below for the desired mutations from section five. Please reword any pathway information you find and reference the source (not just ecocyc.com) omp A lexA Size of gene (bp) 3075 315 rpoA nagC 1221 990 1041 609 Protein Pathway Expected size of PCR (bp) namearrow_forward5arrow_forwardThe following chromatogram is obtained from the sequencing reaction. Using the key below, what message did you integrate into the yeast genome? AATATTAAAGTATAGAACGACTGTGAA A B с D E F G H I AAA AAT AAG AAC ATT ATG ATC AGT AGG J K L M N O P Q R Key GGG GGA GGT GGC GAA GAC GAT GTT GTA S T U V W X Y Z (SPACE) TTT TTC TTA TTG TGT TGA TGG TAA TAGarrow_forward
- The sequence of a template DNA is GGGCCATTCGAACGTCCGAAAATGCCCCTGAATGAAAATTTTGGCCC. The sequence of a primer used for PCR amplification of the above DNA is CCCGGTAAGCTT. Where is the 5' end for the template and primer, respectively? answer options: 1) Left, left 2) Right, left 3) Left, right 4) Right, right 5) Right, leftarrow_forwardThe sequence below shows 140bp of a double-stranded DNA sequence coding for histone H2A. What two primers could be used to amplify the whole 140bp sequence in a PCR reaction? 1 70ATGTCTGGACGTGGCAAGCAGGGAGGCAAAGCCCGCGCTAAGGCCAAGACTCGCTCTTCTAGGGCCGGTCTACAGACCTGCACCGTTCGTCCCTCCGTTTCGGGCGCGATTCCGGTTCTGAGCGAGAAGATCCCGGCCAG 71 140 TCCAGTTCCCCGTGGGCCGAGTGCACCGCCTGCTCCGCAAAGGCAACTATGCCGAGCGGGTCGGGGCCGGAGGTCAAGGGGCACCCGGCTCACGTGGCGGACGAGGCGTTTCCGTTGATACGGCTCGCCCAGCCCCGGCC a. TACAGACCTGCACCGTTC and GGCCGGGGCTGGGCGAGC b. ATGTCTGGACGTGGCAAG and CCGGCCCCGACCCGCTCG c. ATGTCTGGACGTGGCAAG and GCTCGCCCAGCCCCGGCC d. TACAGACCTGCACCGTTC and CGAGCGGGTCGGGGCCGGarrow_forwardCompetent E. coli cells were transformed with the pGLO plasmid. These transformed cells were then allowed to grow on two different plates: 1) a plate containing LB/AMP and 2) another plate containing LB/AMP/ARA. In which plate would you observe both phenotypic and genotypic changes? Briefly justify your answer. Edit View Insert Format Tools Table 12pt v Paragraph v BIUA e T?v 田 D2arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education