Q: A pre-initation complex (PIC) is required for transcription to begin. State which TFII protein has…
A: The pre-initiation complex forms at the core promoter to initiate the transcription of the…
Q: what reaction activates the amino acids for attachment to the appropriate tRNA before being…
A: Translation is the process of synthesis of proteins from mRNA. It is completed in three steps -…
Q: A) Draw the mRNA to be translated if the pre-mRNA is constitutively spliced. [ 3) Draw an mRNA to be…
A:
Q: dsRNA ...
A: Q. Double-strand RNA (dsRNA)________ Answer. Recognized by dicer.
Q: sigma factor: promoter as O protein: DNA O mRNA: tRNA -35 element: GATCC element O elongation:…
A: Transcription is the process of making an mRNA copy of a gene (DNA). It is catalyzed by an enzyme…
Q: 3⁰ A 5 A GC G G A UA A/C UGU P Examine the tRNA above. Which codon on the mRNA strand codes for this…
A: The translation is the process by which polypeptide chain or protein is synthesized from the mRNA…
Q: Review translation. Which step is not a part of elongation cy O binding of small ribosomal unit to…
A: Translation : It is the process which involves formation of proteins from mRNA and ribosomes . This…
Q: 1c. Write in the specific ANTICODON and the specific AMINO ACID in the boxe This image on the right…
A: tRNA is called as transfer RNA and helps in transfer of information from the mRNA to protein (…
Q: ext, let's work through the 1st part of the process: TRANSCRIPTION. sing the sequence found in the…
A: The method of copying a part of DNA into RNA is known as transcription. Messenger RNA is made up of…
Q: intron-Seauence of nueleotides klith in the gene but are r emeved fürm the Ŝeaçuente a final MKNA…
A: Ribonucleic acid (RNA) modifications refers to alteration in the chemical composition of ribonucleic…
Q: give the codon sequences of every code on this tRNA with the anti-codon 5AAG3, could pair with…
A: tRNA are transfer RNA which are responsible for decoding the information on mRNA for the synthesis…
Q: Using the DNA template –TACTGGGTACAAGAACA- for transcription, what is the base sequence of the mRNA…
A: The genetic code is stored in the DNA, which is coded in the messenger RNAs (mRNAs) by a process…
Q: A. Look at the MRNA message below. write the corresponding LRNA on the blank provided…
A: mRNA--- AUG AAG UUC CUG AUC ---->( CODON: Sequence of three nucleotide that encodes a specific…
Q: AMRNA strand has 87 nitrogenous bases. How many amino acids would this mRNA strand code for? 29 D 56…
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: The main function of t-RNA isa) Proof readingb) Inhibits protein synthesisc) Identifies amino acids…
A: Transfer RNA, also known as soluble RNA is an adapter molecule that is composed of 76 to 90…
Q: An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding ntein seque…
A: A single-stranded RNA molecule usually gets to referred as the term messenger RNA (mRNA) is…
Q: 1b) Give the anticodon of the tRNA that would be complementary or a perfect match to the codon…
A: The codon is defined as a sequence of three nucleotide bases on messenger RNA responsible for…
Q: Target of doublestranded rna during RNAi is determined by...... size molecular weight…
A: The gene expression and the stability of mRNA can be regulated by using RNAi techniques in which a…
Q: TRNAS contain the anticodon that interacts with [Select ] [Select] TRNAS MRNAS pre-RNAS
A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum create…
Q: Transcript the template DNA (write in mRNA codons) *
A: The synthesis of messenger RNA with the help of DNA is called transcription. The main enzyme of…
Q: Give the amino acid sequence of the protein encoded by the mRNA in Figure 15.21.
A: Translation is the process of formation of protein by decoding the nucleotide sequence of an mRNA.…
Q: The molecule labelled X is X Polyribosome (Polysome) Ribosome OmRNA O ERNA OFRNA O DNA
A: Multiple ribosomes or polyribosomes making multiple proteins at the same time is simply faster than…
Q: (hitic 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the…
A: Question - 6: Transcription: - The synthesis of mRNA from DNA is called Transcription. - It is a…
Q: Incorrect statement about m-RNAa) Cap is added to the 5’ endb) Introns are removed and exons are…
A: Posttranscriptional modifications are changes that occur to a newly transcribed primary RNA…
Q: emist 19.The last codon sequence in place on a strand of mRNA when a protein is being synthesized at…
A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…
Q: sectio (b) The standard (coding strand) base triplets TAA, TAG an TCA do not correspond with an…
A:
Q: The RISC complex contains: Dicer Argonaute RNAse HI DNA
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Transcribe the following DNA strand into a mRNA strand. AAG
A: Transcription is the process by which the information in a strand of DNA is copied into a new…
Q: Label if each of the fonowing Sequences are present in DNA, pre-RNA andlor MRNA Of eukanyotes :…
A: All the information is present in the DNA that will be required for the synthesis of proteins. In…
Q: To initiate transcription. binds to a specific • called the , located at the 5' end of a gene. DNA…
A: Transcription is the process of making an RNA copy of a sequence of gene. This copy, called as the…
Q: TRNAS contain the that interacts with MRNA. docking bay b. anticodon а. C. codon
A: A transfer RNA is an adaptor molecule made of RNA that is typically 76 to 90 nucleotides long (in…
Q: TAG CCG ATA GCT TGA Translate the gene above into a protein . Please write the three letter code…
A: Codon is a sequence of three nucleotides that encodes an amino acid. Codons together form a unit of…
Q: Using the provided čoding strand below 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the anticodons…
A: DNA is two stranded ladder like structure which comprises of :- A) Coding strand B) Template…
Q: 8 QUESTION: Transcribe the gene. Write out the correct sequence of mRNA bases. Notice that this is…
A: Transcription is the synthesis of RNA from DNA segment with the help of RNA polymerase enzyme. It…
Q: BONUS: Within a cell, positive sense single stranded RNA acts as O FRNA O SİRNA tRNA O MRNA
A: Introduction: Positive-strand RNA viruses or +ssRNA viruses are a group of viruses that are related…
Q: Eukaryotic RNA polymerases can be distinguished by their sensitivities to ( ). 50 Each bacterial…
A: Eukaryotes have mainly three types of RNA polymerases that transcribes different types of RNA. RNA…
Q: TRNA is synthesized during transcription. OTrue O False Next Page Back
A: Tranfer RNA is a type of RNA molecule that help decode a messanger RNA and specifies an amino acid…
Q: DNA ONA 200000 700000 -MRNA Polypeptide- Chain Polypeptide- Chain Ribosome MRNA Ribosome Student 1…
A: The process of the formation of mRNA from the DNA strand is known as transcription. It is the first…
Q: Anticodon Anticodon Anticodon 3 1 5'-IAG-3' 5'-UAU-3' 5'-AAA-3' codon MRNA 5'- -3' 5' _3' 3' 5' 3. 1…
A: Multiple subparts are there in question. I will answer first 3 subparts, as per guidelines. In RNA,…
Q: BONUS: In Bacteria, catalyzes formation of peptide bonds during translation (answers must be in…
A: RNA nucleotides are linked together by 3’-5’ phosphodiester linkages. The three min RNA in all the…
Q: TACGGTACGATT CYTOPLASM Transcription a. On the diagram, draw a circle around the part that…
A:
Q: Matching type Choices are in the picture 1. simultaneous and rapid process producing mRNA and…
A: DNA instructs everything in the cell and is expressed in the form of proteins coded by DNA itself.…
Q: ndicate the codons of the three amino acids involved. (SerineTyrosineGlysine.
A: introduction By utilizing the as of late created man-made DNA shaper [a mix of Ce(IV)/EDTA and two…
Q: 12. The following codons and the amino acids they encode is as follows: AUG = Met %3D UUU, UUC = Phe…
A: ANSWER;- a) The sequence of amino acids in the following structure Met-Phe-Leu-Ser-Thr-Pro b)(i) DNA…
Q: What is the tRNA triplets codon that would fit the mRNA- 5' AUG AUC UAU GGG CCA AUU GCA UGA 3'
A: The three triplets which are complementary to the mRNA sequence forms the anticodon in transfer RNA.…
Q: Describe Information Transfr Replicetion - Transcuiption Tronslation
A: Genes and genomes play an important role in information processing. The genetic material of the cell…
Q: CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT…
A: The process of synthesizing mRNA strand with the help of template stand of DNA is called…
Explain The mRNA codon of valine is:
GUC
UGG
CCA
TTG
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A GGiven the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codon
- Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript (written 5'-> 3'): AUGCCUGACUUUAAGUAGWhat amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter abbreviation with hyphens and no spaces in between.A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?
- The mRNA codon of valine is GUC UGG CCA TTGThe codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine ThreonineWrite the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC GCG CGG UAA-3'
- Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First Position
