With respect to an intron, which one of the following options would be a good way to identify the location of the branchpoint? A located 15-45 bases from 3’ splice junction GU located at the 5’ splice site AG located at the 3’ splice site AAUAAA near the 3’ UTR

With respect to an intron, which one of the following options would be a good way to identify the location of the branchpoint? A located 15-45 bases from 3’ splice junction GU located at the 5’ splice site AG located at the 3’ splice site AAUAAA near the 3’ UTR

Name: With respect to an intron, which one of the following options would be
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: With respect to an intron, which one of the following options would be a good way to identify the location of the branchpoint?A located 15-45 bases from 3’ splice junctionGU located at the 5’ splice siteAG located at the 3’ splice siteAAUAAA near the

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 13QP

See similar textbooks

Similar questions

Arrange the following list of eukaryotic gene elements in the order in which they would appear in thegenome and in the direction traveled by RNA polymerase along the gene. Assume the gene’s singleintron interrupts the open reading frame. Note thatsome of these names are abbreviated and thus do notdistinguish between elements in DNA versus RNA.For example, splice-donor site is an abbreviation forDNA sequences transcribed into the splice-donor sitebecause splicing takes place on the gene’s RNA transcript, not on the gene itself. Geneticists often usethis kind of shorthand for simplicity, even thoughit is imprecise. (a) splice-donor site; (b) 3′ UTR;(c) promoter; (d) stop codon; (e) nucleotide towhich methylated cap is added; (f) initiation codon;(g) transcription terminator; (h) splice-acceptorsite; (i) 5′ UTR; (j) poly-A addition site; (k) splicebranch site.
Question #1: In 1966, a mouse was found in the Jackson Laboratory colony that seemed to be excessive in weight as compared to its wildtype siblings from the same litter. The allele that was assigned to this mouse was called "db". Given the data from the original 1966 paper below, a) is there evidence of a genetic basis for an increased overall weight of the mutant mouse? b) Is this mutant phenotype encoded by a dominant or recessive gene? Please provide an explanation of your answers. Table 1. Body weight of diabetic (dbdb) and normal (++ and + db) mice. Sexes are combined. Age (weeks) 2- 3 3-4 4-5 5-6 6-7 7-8 8-9 9-10 10-11 11-12 12-13 13-22 23-54 No. of mice 6 12 25 20 16 12 10 11 11 7 5 11 5 dbdb Av. 6.7 14.8 19.8 25.4 28.3 32.4 34.5 37.9 39,4 38.1 44.4 45.3 45.9 Weight (g) Range AG|GŽAAAC 7- 10 9- 20 10-27 14- 34 18-39 21-42 31-41 31-44 32- 45 last two nucleotides of the 106 bp 32-46 34-51 32- 62 37-61 No. of mice 7 21 16 19 17 17 5 26 ++and+ db Av. 7.6 11.3 16.9 18.5 19.8 21.9…
A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition= lys-ser-pro-ser-leu-asn-ala-ala-lys mutant form= lys-val-his-his-leu-met-ala-ala-lys. Decipher the segment of mRNA for both the original protein and the double mutant. Which base was added? Which was deleted?
This is the sense strand of a mammalian gene. Determine the sequence of the mature mRNA. Assume transcription starts approxiamtely 25 bp downstreams from the TATAAT box, that the 5' splice site is AG/GUAAGU and that the 3' splice site is AG\GN. / marks the 5' splice site and \ marks the 3' splice site. N means any nucleotide. (In this problem, there are no branch point A's or polyY tracts. Please mark the splice sites as defined above. (5'=/ and 3'=\) and underline the mature mRNA. Do not use alternate splicing. TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGT ATGATAGGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATAATTAAGCACAGGCATGCA GGGATATCCTCCAAATAGGTAAGTAACCTTACGGTCAATTAATTAGGCAGTAGATGAATAAACGATAT CGATCGGTTAGGTAAGTCTGAT
Telomerase supplies its own template RNA molecule as shown in Figure 3 below: B AAUCCCAAU TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the ends (5' and 3') on the DNA and RNA strand at position X, Y and Z, in the Figure 3. (ii) Draw and explain the two loop structures at the end of telomere.
The sequence of the sense strand of a mammalian gene is (shown). Determine the sequences of the mature RNA and the encoded protein. Assume that transcription initiates at a G approximately 25 bp downstream of the TATAATA sequence, that each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G (where / marks the location of the splice).
Splice sites on mRNAs are located with the help of all of the following EXCEPT: Question 9 options: Small nuclear ribonuclear proteins (SNRPs) Recognition of a GC-rich consensus sequence within the intron Recognition of an AT-rich consensus sequence within the intron Recognition of a GC-rich consensus sequence overlapping an exon on the 5' end Pyrimidine-rich sequences within the intron
A poison added to an in vitro translation mixture containing mRNA molecules with the sequence 5'- AUGAAAAAAAAAAAAUAA-3' has the following effect: the only product made is a Met-Lys dipeptide that remains attached to the ribosome. What is the most likely way in which the poison acts to inhibit protein synthesis? It mimics a methionine tRNA. O It inhibits stop proteins from entering the ribosome O It inhibits movement of translocation so it can't empty the P-site O It inhibits the P site from accepting a tRNA to begin with
Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the one-letter abbreviation of the protein product of the mRNA transcript?
Below is the RNA sequence of a primary transcript. Underline (or highlight) each intron, and then clearly show a point mutation that would prevent intron two from being spliced out. Assume each intron is spliced using the 5' and 3' splice sites that are closest to each other. GCUACGACGAUGGAUGCGACUCGUUCACAGACUGAGGCUUGAUUGUCAGAACGCGCUGGAUGAUAGCUUGAUCGAUAAUAAACGACUACGAUCGCUCGAUCGAACGACCG
In one form of thalassemia, the mutation of a single base from G to A generates a new 3' splice site that is farther upstream from the normal site. The normal and mutated sequences show the sense DNA strands of a normal and thalassemic patient. 5' CCTATTGGTCTATTTTCCACCCTTAGGCTGCTG 3' 5' CCTATTAGTCTATTTTCCACCCTTAGGCTGCTG 3' 3' end of mutated intron New start of reading frame Normal 3' end of intron What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient that results from the aberrant splicing? Use the codon table and write the peptide sequence using three-letter amino acid abbreviations separated by hyphens. amino acid sequence: Pro-The-Ser-Leu-Phe-Ser-Thr-Leu-Arg-Leu-Leu Incorrect
The U1 splice donor site is critical for positioning of the U1snRNP for appropriate splicing. What site/region(s) participates directly in the phosphoester bond exchange that forms the lariat leading to the correct excision of the intronic segment? Options: the branch point adenosine the poly A stretch within the intron (high conservation ~80%) U2AF binding site (GU) at the 3' intron/exon junction a and b only a, b and c