Answered: Which primer will anneal to this…

Which primer will anneal to this strand, and elongate during PCR? 5’ ATGCGGTTAC 3’ Group of answer choices 5’ GTAA 3’ 5’ ATGC 3’ 5’ TTAC 3’ 5’ GCAT 3’

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Match the term in column 2 (A-G) with its definition in column 1. DOD Cloning vector Genome editing…

A: In the molecular biology, various techniques empower scientists to unravel the mysteries encoded…

Q: Which activity of E. coli DNA polymerase I is responsible for proofreading the newly synthesized…

A: The first known polymerase is the DNA Polymerase I. It is the enzyme that participates in…

Q: In Ex 1.1 we used the Wizard DNA isolation kit to isolate the pCR2.1 vector and in Ex 1.11 we used…

A: The Wizard DNA isolation Kit is designed for the isolation of DNA from tissue culture cells, animal…

Q: 49 Identify which PCR primer that could be used to amplify the gene shown (choose all correct…

A: Since there are multiple questions in this particular question, I will answer the first one for you.…

Q: Nde I EcoR I Sal I Kpn I BamH I PUST MCS ori Xho 1- Ampe BamH I Kpn I EcoR I BamH I gene W Xhe

A: Introduction A chemical reaction is a process in which the reactants are converted into a product…

Q: A PCR reaction was performed to amplify the CHE2 gene. The PCR primers used were designed to amplify…

A: Polymerase chain reaction is a molecular biology technique that is sued to synthesize multiple…

Q: To quantify the transcription product of a specific gene in E. coli, you may use (select all correct…

A: Introduction The Process Of Transcribing A Piece Of DNA Into RNA Is Known As Transcription.…

Q: The short sequence shown below is part of a gene of interest. You decide to amplify this part of the…

A: In PCR, primers serve as the initial building block for DNA synthesis. DNA synthesis is carried out…

Q: 1). DNA polymerase III is the bacterial replicative polymerase. It is comprised of subunits derived…

A: DNA polymerase III transcribes the genetic code in bacteria. Polθ and Poleε subunits function as…

Q: 4. In your PCR reactions, you are using a mastermix that has that has an optimum Taq activit…

A: Polymerase Chain Reaction is a procedure that enables us to make numerous copies of a strand of…

Q: Site-directed mutagenesis involves: (MARK ALL THAT APPLY) Group of answer choices Joining two DNA…

Q: 18. You want to express hemoglobin beta (HBB) in a bacteria model using a vector. You would like to…

A: PCR (Polymerase Chain Reaction) is a laboratory technique used to amplify specific regions of DNA.…

Q: A student carries out PCR using the following steps: step 1: 94C for 1 minute Step 2: 60C for…

A: A complete set of chromosomes in any species is regarded as its genome. Each chromosomes homes DNA…

Q: You are using these two plasmids to make a recombinant DNA molecule. You want to make a molecule,…

A: Recombinant technology includes the process in which we can introduce our gene of interest with a…

Q: Hindl EcoRI ECORV BamHI 373 Salt Pstl. tet amp Plasmid 1000 DBR322 4361 be ori Ndel you were going…

A: Restriction enzymes or restriction endonucleases/exonucleases are enzymes capable of recognizing a…

Q: Indicate the purpose of the following in PCR Step Item added Purpose Step 1 Primers Step 2…

A: In microbial identification testing, PCR is utilized. It may be utilized as a tool, which is…

Q: 5. Show the separation pattern of the following DNA molecules on an agarose gel electrophoresis. 5…

A: Forms of DNA gives different band pattern.

Q: All are propertles of nucleosomes EXCEPT: / Almal is eienskappe van nukleosome, behalwe: A. all are…

A: Nucleosome They are fundamental repeating subunits of all eukaryotic chromatin (except when…

Q: When using the plasmid shown below for cloning, which restriction enzyme site(s) (all indicated with…

A: A plasmid is a double-stranded DNA molecule that is small and circular in shape. Bactria and yeast…

Q: 30) In the CRISPR system, the targeted DNA sequence is

A: CRISPR stands for clustered, regularly interspaced short palindromic repeats. Engineered CRISPR…

Q: If the cloning was successful and the plasmid contained the elements needed for blue-white…

A: The screening of transformants after the cloning is a critical step as it allows the identification…

Q: 25. The restriction enzymes Kpnl and Acc65l recognize and cleave the same 6-bp sequence. You have a…

A: Restriction enzymes are the DNA digesting enzymes.

Q: why H is 5' and E is 3'.

A: DNA replication is the process through which cells make copies of the genome's DNA. A cell must…

Q: vector pUST, gene W, and the restriction cut sites. What are 3 cutting strategies for cloning gene W…

A: *Cloning means producing an organisms with identical DNA either by natural or through artificially .…

Q: You would like to amplify the gene shown below using PCR with two primers: the primers are shown on…

A: Explanation: A specific area of DNA is amplified using PCR. Primers, which are compact fragments of…

Q: Why is taq polymerase used in pcr reactions.

A: Step 1 Polymerase chain reaction (PCR) sometimes also called molecular photocopying is a technique…

Q: You've ordered and received your "primers" for your PCR. Now what? In your new role as an MLA your…

A: A primer is a short, single-stranded DNA sequence which is used in the polymerase chain reaction…

Q: Describe precisely the catalytic activity of DNA polymerase I that removes RNA primers. O 3' to 5'…

A: An enzyme called DNA polymerase I (also known as Pol I) takes involved in bacterial DNA replication.…

Q: What the most likely cause of mutation CCC to CCG? Select an answer and submit. For keyboard…

A: Mutation as the process of changing or cause a permanent change in the DNA of an organism. This can…

Q: Design primers for PCR that would be able to amplify this entire DNA fragment. -Design the primers…

A: AThe primer sequence is as follows: FORWARD PRIMER: 5' GCTCAGG 3' REVERSE PRIMER: 5'TCTATTA3'

Q: 1) you have a locus in your PCR reaction that is a DNA squence is on the fifth chromosome, is a…

A: Gel electrophoresis is a common laboratory method used for the separation of DNA, RNA, or proteins…

Q: In E. coli, the leading strand is primarily synthesized by: DNA polymerase ε DNA polymerase…

A: DNA replication is a process in which the DNA makes multiple copies of itself. The cell must…

Q: In Reverse Transcription PCR, what step is added the ordinary PCR? Provide short explanation in the…

A: Transcription: It is the process through which the enzyme RNA Polymerase transfers information from…

Q: 19. You run a PCR of the above HBB sequence using the primers you designed. You receive a vector…

A: i) Gel Electrophoresis Bands:- The ladder serves as a reference for the sizes of the DNA fragments.-…

Q: 1. a. Draw the primers for this longer strand (consider optimal length):…

A: Introduction PCR is the revolutionized technique invented by Karry Mullis in 1983, for which he got…

Q: 8. You perform a PCR experiment using the template and primers shown below. What size is the…

A: PCR stands for Polymerase Chain Reaction. It is a laboratory technique used to amplify a single or a…

Q: 1. Drag the red box to indicate the restriction site in the following sequence. 5-.. АТА ТСА TСС TGT…

A: Genetic engineering is one of main principles of biotechnology. It is a process of manipulation of…

Question

54.

Which primer will anneal to this strand, and elongate during PCR?

5’ ATGCGGTTAC 3’

Group of answer choices

5’ GTAA 3’

5’ ATGC 3’

5’ TTAC 3’

5’ GCAT 3’

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Design PCR primers for the DNA sequence given below and explain your choice. As part of your answer, draw a schematic of PCR primers binding to the DNA template. 5'-ATGGGGTCAGTCATGGTTA... .TTTATCGTGCATGTGATGTG-3'
5
52.Describe the basic processes of DNA clone by using E.coli 155 1202020155
25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3' 5' GGTACC3' 3 CCATGGS 3 CCATGGS Kpnl Aсс651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.
Please help with question
Which of the following DNA pol I activities would be MOST important in the removal of the primer? ability to nick both strands of the DNA 5' to 3' exonuclease activity 3' to 5' exonuclease activity polymerase activity
5
Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )
Consider the ends of the DNA fragments shown below. They have been produced by digestion of a single sequence of DNA using a number of restriction endonucleases. 1. 5'A 3' 3'TTCGA5' 2. 5'G 3' 3'CAGCT5' 3. 5'AATTC3' 3' G5 4. 5'TCGAC3' 3' G5' 5. 5'GGG 3' 3'CCC 5' Which of these ends are capable of annealing and being joined by DNA ligase?
Which of the following substances adds equivalent DNA nucleotides to the 3' end of Okazaki fragments after primers are removed? Group of answer choices helicase DNA ligase DNA polymerase I DNA polymerase III
8.