
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Consider the ends of the DNA fragments shown below. They have been produced by digestion of a single sequence of DNA using a number of restriction endonucleases.
1. |
5'A 3' 3'TTCGA5' |
2. |
5'G 3' 3'CAGCT5' |
|
|
||
3. |
5'AATTC3' 3' G5 |
4. |
5'TCGAC3' 3' G5' |
|
|
||
5. |
5'GGG 3' 3'CCC 5' |
|
Which of these ends are capable of annealing and being joined by DNA ligase?
SAVE
AI-Generated Solution
info
AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.
Unlock instant AI solutions
Tap the button
to generate a solution
to generate a solution
Click the button to generate
a solution
a solution
Knowledge Booster
Similar questions
- Please both partsarrow_forward1. Briefly explain why the total size of the pMBBS plasmid in the Restriction Enzymes practical is 3000bp (base pairs) 2. Briefly explain why the cut sites on the pMBBS plasmid in each Restriction Enzymes (EcoRI, BamHI, and XhoI) just 1 each 3. Briefly explain what led to the 5 fragments formed which linked to the 500bp, 1000bp, 1500bp, 2000bp, 2500bp sizesarrow_forward16. Which of the following enzyme repairs the DNA backbone during molecular cloning (that is you are inserting the DNA fragment into a plasmid and the bases in the sticky ends are aligned but the backbone needs to be repaired). a) reverse transcriptase b) restriction enzymes c) DNA ligase d) polymerasearrow_forward
- If a uidA amplicon generateed by PCR is 200bp and the DNA fragments resulting from the restriction digest fall with 1000bp and 4000bp, which gel should be more concentrated? a) Higher concentration agarose b) Lower concetration agarose?arrow_forwardUse the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. IF the EcoRI/BamHI double digest produces 3 fragments with only two sizes, what are their sizes? 2.5 kb, 250 b and 250 b 3.0 kb 2.0 kb 500 b and 500 b 3.0 kb 1.0kb and 1.0 kbarrow_forwardA PCR reaction was performed to amplify the XULA3 gene, which is bp 882-5,364 on a plasmid that is 11,719 bp. After the PCR, the product was digested with XhoI. There are XhoI sites on the plasmid at bp 1,434, 4,655, and 7,368. Calculate the size(s) that would result when the product is digested with XhoI. Then enter the size of the largest fragment (in bp).arrow_forward
- For the plasmid below, list the origin and what antibiotic you would use for selection?arrow_forwardThe sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product which is cloned into a 1.5 kb plasmid for bacterial expression. What would the agarose gel look like, including a lane for markers, and where would the following pieces of DNA run: 1. the PCR insert 2. the empty uncut plasmid 3. the empty plasmid cut with a single restriction enzyme 4. the cloned plasmid containing the insertarrow_forwardWhich of the following scenarios would ONLY occur if your skipped the digest purification step? UV/VIS spectrophotometric quantification of DNA may be skewed by uncut plasmid. Some plasmid molecules may be cut once, by one enzyme, and re-ligate to themselves. The fragments cleaved by the restriction enzymes on the plasmid and insert can re-ligate to their sites, causing reduced ligation efficiency. Plasmid molecules cut with EcoRI and Xbal can ligate to each other instead of the insert.arrow_forward
- Bacterial systems serve as an excellent model to express proteins but has a disadvantage – what is that disadvantage? List the points to differentiate three classes of restriction enzymes? Give an example of restriction enzyme that has ability to generate blunt and cohesive ends after digestion of DNA?arrow_forwardDNA samples from four individuals were cleaved with the same MW restriction endonuclease. The DNA fragments were separated by gel clectrophoresis, transferred to a membrane, and hybridized with a 12 kb 10 kb DNA probe complementary to a region between sites C and D (see 8 kb hybridization line). The image of the southern blot shows the labeled DNA bands and 6 kb molecular weight (MW) markers. The lane labels I, II, III, and IV -5 kb correspond to individuals I, II, III, and IV. Assume that fragments such as C-D and C-E are clearly resolved in this gel system. Fragment sizes are as given: A-B is 4 kb, B-C is I kb, C-D is 5 kb, and D-E is 650 bp. Individual I has five cleavage sites (A, B, C, D, and E) for the restriction endonuclease. DNA homologous to probe Which individual has at least one point mutation that eliminates restriction site C only? O II IV cannot be determined II Which individual has at least one point mutation that climinates restriction sites B and C? III O IV cannot be…arrow_forwardA DNA sequence is shown below, which includes a gene as marked. You have the restriction enzymes SalI and HindIII available to you to excise the gene prior to its incorporation into a plasmid vector. Which would you use to excise the gene?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education