Consider the ends of the DNA fragments shown below. They have been produced by digestion of a single sequence of DNA using a number of restriction endonucleases. 1. 5'A         3' 3'TTCGA5' 2. 5'G          3' 3'CAGCT5'     3. 5'AATTC3' 3'         G5 4. 5'TCGAC3' 3'         G5'     5. 5'GGG 3' 3'CCC 5'   Which of these ends are capable of annealing and being joined by DNA ligase?

If a uidA amplicon generateed by PCR is 200bp and the DNA fragments resulting from the restriction digest fall with 1000bp and 4000bp, which gel should be more concentrated? a) Higher concentration agarose b) Lower concetration agarose?

Use the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. IF the EcoRI/BamHI double digest produces 3 fragments with only two sizes, what are their sizes? 2.5 kb, 250 b and 250 b    3.0 kb    2.0 kb 500 b and 500 b    3.0 kb 1.0kb and 1.0 kb

A PCR reaction was performed to amplify the XULA3 gene, which is bp 882-5,364 on a plasmid that is 11,719 bp. After the PCR, the product was digested with XhoI. There are XhoI sites on the plasmid at bp 1,434, 4,655, and 7,368. Calculate the size(s) that would result when the product is digested with XhoI. Then enter the size of the largest fragment (in bp).

For the plasmid below, list the origin and what antibiotic you would use for selection?

The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product which is cloned into a 1.5 kb plasmid for bacterial expression.  What would the agarose gel look like, including a lane for markers, and where would the following pieces of DNA run: 1. the PCR insert 2. the empty uncut plasmid 3. the empty plasmid cut with a single restriction enzyme 4. the cloned plasmid containing the insert

Which of the following scenarios would ONLY occur if your skipped the digest purification step? UV/VIS spectrophotometric quantification of DNA may be skewed by uncut plasmid. Some plasmid molecules may be cut once, by one enzyme, and re-ligate to themselves. The fragments cleaved by the restriction enzymes on the plasmid and insert can re-ligate to their sites, causing reduced ligation efficiency. Plasmid molecules cut with EcoRI and Xbal can ligate to each other instead of the insert.

Bacterial systems serve as an excellent model to express proteins but has a disadvantage – what is that disadvantage? List the points to differentiate three classes of restriction enzymes? Give an example of restriction enzyme that has ability to generate blunt and cohesive ends after digestion of DNA?

DNA samples from four individuals were cleaved with the same MW restriction endonuclease. The DNA fragments were separated by gel clectrophoresis, transferred to a membrane, and hybridized with a 12 kb 10 kb DNA probe complementary to a region between sites C and D (see 8 kb hybridization line). The image of the southern blot shows the labeled DNA bands and 6 kb molecular weight (MW) markers. The lane labels I, II, III, and IV -5 kb correspond to individuals I, II, III, and IV. Assume that fragments such as C-D and C-E are clearly resolved in this gel system. Fragment sizes are as given: A-B is 4 kb, B-C is I kb, C-D is 5 kb, and D-E is 650 bp. Individual I has five cleavage sites (A, B, C, D, and E) for the restriction endonuclease. DNA homologous to probe Which individual has at least one point mutation that eliminates restriction site C only? O II IV cannot be determined II Which individual has at least one point mutation that climinates restriction sites B and C? III O IV cannot be…

A DNA sequence is shown below, which includes a gene as marked. You have the restriction enzymes SalI and HindIII available to you to excise the gene prior to its incorporation into a plasmid vector. Which would you use to excise the gene?