Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myeloid leukaemia Select one: A.t(8;21) translocation (RUNX1‐RUNXT1 fusion) B.DNMT3A mutation C.TP53 deletion D.NPM1 (nucleophosmin) mutation

Q: When human hemoglobin undergoes a mutation, the mutant protein usually does not replace all of the…

A: The cytosol of red blood cells contains the oxygen-carrying globular protein hemoglobin, which is…

Q: A 25-year old man is concerned about his fmaily history of ankylosing spondylitis. He has not yet…

A: Ankylosing spondylitis is a condition where prolonged inflammation can lead to the fusion of bones…

Q: Defects in this gene have been associated with metastasis in pancreatic cancer. Select one: O a. APC…

A: Answer : Option "G" is correct - BRCA1

Q: Even single point mutations can have a significant effect on protein function. Describe how point…

A: A point mutation is a mutation that only affects a single nucleotide of nucleic acid. Point…

Q: Match the gene name with the gene description. rb BRCA-1 A. tumor suppressor - p53 B. proto-oncogene…

A: Cancer is a condition caused by mutation in the genome that results in infinite cell multiplication…

Q: Which of the following statements are correct about cancer drug resistance (select all that apply)?

A: Cancer drug resistance is the acquired after treatment effects that many of the Cancer Patients…

Q: which of these describes the symptoms of the disease(s) caused by mutations in this gene…

A: Mutation in the following gene i.e. XPA gene, causes malfunctioning of DNA repair mechanisms of our…

Q: Developing B cells that fail to make productive D to J heavy-chain rearrangements on both homologous…

A: B cells get matured in the bone marrow or in the lymph node. Mature B cells express antibodies on…

Q: Chromosomal translocations AND mutations in cadherin binding sites can result in cancer. Select one:…

A: Introduction: When a segment of one chromosome separates and joins another chromosome, the process…

Q: Which ONE of these is TRUE regarding the aetiology of acute lymphoblastic leukaemia (ALL)? Select…

A: in regarding of the aetiology of Acute Lymphoblastic Leukemia (ALL)

Q: A 20-year-old primigravida gives birth to an infant. The infant had immediate respiratory distress…

A: Introduction:-  Thanatophoric dysplasia is a lethal skeletal dysplasia that is characterized by…

Q: i) A couple each having sickle cell trait have five children. What is the probability that they will…

A: Sickle cell disease (SCD) is a genetic disorder that follows the autosomal recessive pattern of…

Q: valy All adrenoleukodystrophy patients carry the same mutation in the ABCD1 gene, however their…

A: Above is the illustration of a cell with Adrenoleukodystrophy.

Q: (a) Identify both the cellular component and the location of the component that is responsible for…

A: Luciferase reporter produces luminescence. If cells contain a luciferase vector, the luminescent…

Q: Explain the connection between the founder and the G8-C marker.

A: In this example the original mutation that caused  the huntington allele occurred in a germline cell…

Q: The initiation complex for translation includes transfer RNA-MET. Select an answer and submit. For…

A: During initiation,at the start of mRNA sequence the small ribosomal subunit binds.Then a tRNA…

Q: the following processes except a.         alternative splicing to produce a secreted form of the…

A: Answer  1st answer - d) somatic recombination 2nd answer - d) CTLA4, SUPPRESSION

Q: High dose chemotherapy given prior to stem cell transplant may be associated with gonadal failure.…

A: Chemotherapy is a cancer treatment that uses powerful drugs to kill or slow down cancer cells. It…

Q: Using the AAV virus you created in the simulation, you introduce it to a mouse model for heart…

A: Viruses are minute particles that are made up of only their genetic material which may be DNA or RNA…

Q: Answer the following multiple-choice questions about cancer-promoting mutations. A gene whose…

A: Cancer cells by definition, proliferate in defiance of normal controls and are able to invade and…

Q: 3.3. Using your knowledge of the function of p53, discuss why targeting mutant p53 is promising for…

A: The p53 protein is a tumor suppressor that plays a crucial role in preventing the formation and…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia is a disease that interferes in the production of normal blood cells. It is a…

Q: Given below is the electrophoretic profile of 2 proteins, a normal hemoglobin, HbA and the fetal…

A: Protein electrophoresis is a method that separates proteins based on their size and the electrical…

Q: The first mutation is thought to occur in utero in most cases of ALL diagnosed before age 5 years…

A: Acute Lymphoblastic Leukemia (ALL) is a type of blood cancer that affects white blood cells. It is…

Q: Which ONE of the following genetic patterns defines a patient with acute myeloid leukaemia with the…

A: Any kind of alteration in the nucleotide sequence of an organism’s genome is referred to as a…

Q: Humanized monoclonal antibodies are best described as a. antibodies made in mice in which the…

A: Ans: The antibodies generated in the laboratory that specifically binds to single epitope or antigen…

Q: Cancer Cells need A.I.R in order to survive and proliferate. What does this stand for?   a.…

A: Oncogene activation requires genetic alterations in cellular protooncogenes. The result of these…

Q: The malformed hemoglobin protein is an example of the relationship between genes and traits at the:…

A: Sickle cell anemia is a genetic disorder arising from a specific variant within the HBB gene,…

Q: Define the following terms: a. cell transformation b. oncogene c. apoptosis d. early response gene…

A: Gene regulation is the mechanism that acts to induce or repress the expression of the gene.that…

Q: Which of these describes the symptoms of the disease(s) caused by mutations in KMT2D ? Select all…

A: For a protein participating in a critical biological activity, such as DNA synthesis or cell…

Q: Describe two mutations that are associated with the development of leukaemia and how these two…

A: The type of cancer that will begin in the blood-forming tissue, generally in the bone marrow, is…

Q: Which of the following statements best explains why the immune system can continue to make…

A: Rituximab is a medication that will be mostly used for treating rheumatoid arthritis as well as…

Q: Define the following terms: a. anti nucleoside b. HGPRT c. Lesch–Nyhan syndrome d. purine salvage e.…

A: The branch of biology that deals with the structure, function, and manipulation of the…

Q: what are the consequences of anemia and leukopenia during chemotherapy

A: Chemotherapy causes leukopenia and anemia.  As chemotherapy destroys the fast growing tumor cells,…

Q: Jonah and Jana are siblings. Jonah has the genetic disorder cystic fibrosis, caused by inheriting…

A: Cystic fibrosis is an inherited genetic disorder that damages the lungs and digestive system.

Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…

A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…

Q: Based on the data provided, explain how cellular processes must be altered in stomach cancer cells…

A: In comparison to healthy cells, cancer cells have an active metabolism and need more energy. Cancer…

Q: with Nonpolyposis colorectal cancer and his biopsy pathology report reveals a defect in some TSGs…

A: Non polyposis rectal cancer may have a hereditary origin linked to it as few mutations in certain…

Q: A study was conducted to determine the importance of Nucleoid Associated Proteins (NAPs) by deleting…

A: 1- Nucleoid-associated protein (NAPs): These are small DNA binding proteins which can alter the DNA…

Q: Define the following terms: a. asparagine-linked oligosaccharide b. mucin-type oligosaccharide c.…

A: Introduction : Any foreign substance that is responsible for generating an immune response in the…

Q: Please answer all questions if possible.  -B-Raf is not overexpressed in cancer though shows…

A: B raf is a protooncogene that produce BRaf protein. This protein plays role in regulating MAP…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.