Which of the following statements about genetics of Alzheimer's Disease (AD) is correct? A. Production of ApoE3 can lead to AD. B. A decrease in B-secretase can lead to AD. C. Trisomy 21 decreases the probability of early onset AD. D. Mutations in presenilin 1 or 2 can lead to AD. OO00
Q: World Health Organisation's global action plan on dementia
A: Dementia is one of the main causes of disability and dependency in older adults. It can be decreased…
Q: "Using the concepts and techniques you have learned from the two labster simulations, provide…
A: Monogenic inherited disorders are brought about by a mutation in one single gene. Every one of these…
Q: What is Transcranial Magnetic Stimulation and how does it work?
A: Transcranial magnetic stimulation, abbreviated as TMS or rTMS is a non-invasive procedure, i.e., it…
Q: o certain drugs something that is genetically inherited? Explain
A: Addictions are a various set of common, complicated diseases that are to some extent tied along by…
Q: A group of 200 patients who suffer from seizures is asked to participate in a study to determine the…
A: Clinical trials are approved methods of understanding the outcomes of various new treatments in…
Q: Herceptin is an antibody that binds to a class of oestrogen receptors and is used to treat some…
A: Introduction: The unregulated proliferation of cells in the breast area is known as breast cancer.…
Q: The Part II: Cellular senescence is observed when there is obstruction of the coronary circulation…
A: The heart is a significant organ that provisions blood to the entire body and the coronary artery…
Q: Why are men aggressive and violent, in every culture on the planet, and across all human history?…
A: Aggression can be correlated with the gender of humans. Men possess a universal tendency to be more…
Q: The FOXP gene strongly affects what else, in addition to brain development? A. The stomach and…
A: Forkhead box protein P2 (FOXP or FOXP2) is a protein that is encoded by the FOXP2 gene in humans.…
Q: Mitochondrial disease is a trigger of Alzheimer disease?
A: Alzheimer's is a chronic neurodegenerative disease, which occurs due to death of brain cells. This…
Q: 1. When you read a sagittal head CT, you can identify most lesions by comparing A left and…
A: Autism refers to a set of various conditions like challenging with social skills, impairment in…
Q: Could you please mention/explain some limitations and extensions (three each) associated with the…
A: Genetic engineering, often known as genetic alteration, is the use of biotechnology to directly…
Q: Most mild intellectual disability is believed to be caused by A. A combination of environmental and…
A: Intellectual disability (ID), also known as a general learning disability and mental retardation…
Q: Choose one of the following viewpoints to answer this question: social or economical Clearly state…
A: 1 .Yes, as I would like to think Canadian government should build the financing of Alzheimer's…
Q: Alzheimer's disease is a progressive neurological degenerative disorder that affects almost 50…
A: Neurotransmitters are the chemical molecules that help in the transmission of information from one…
Q: In neurofibromatosis the phenotype does not always correspond to the genotype, what is this effect…
A: Neurofibromatosis is a genetic disorder. It affects nerve tissues and causes tumor of the brain,…
Q: In the process of normal aging, the Select one: a. weight of the brain gradually decreases b.…
A: In the normal process of aging, weight of the brain gradually decreases. These changes most commonly…
Q: “Correlation does not prove causation” means that (a) if two variables are correlated, one is likely…
A: Answer: Introduction: Heritability means estimation of phenotypic characters variation in a…
Q: a. List the differences between infectious and genetic diseases.
A: Introduction Disease:- Any condition which impairs the health, or interferes with the normal…
Q: Consider what you discovered about the types of mutations in questions 4 and 5. How could these…
A: Alzheimer's disease causes the brain's atrophy to shrink and the cells of the brain to die. Dementia…
Q: The biogenic amine hypothesis of schizophrenia suggests: Question 43 options: a) That changes in…
A: Schizophrenia is a condition characterized by long term mental disorder in which person loss…
Q: Dr. Sontag, a behavioral geneticist, wants to study the heritability of musical talent. Which of…
A: The scientific studies are well organized and structured that are based on facts and evidence. The…
Q: Studies have conclusively linked the MMR to the onset of autism. true or false?
A: Autism spectrum disorder, simply, autism is a disorder of brain development that mainly occurs…
Q: Nowadays, diabetes is a common disease. Diagram with labels, how can stem cell therapy be used to…
A: Stem cells are the cells which are undifferentiated they have the ability to self renewal and these…
Q: Choose all that are false when considering the adaptive response to tan. a) The ability to tan…
A: Choose all that are false when considering the adaptive response to tan. Ans : b) It is a cellular…
Q: Is Genetics a Factor in Parkinson's Disease?
A: Parkinson's disease is a progressive nervous system condition. The condition affects numerous brain…
Q: Which of these is a likely conclusion about the role of genetics in schizophrenia?A. An aberrant…
A: Schizophrenia is a mental disorder wherein the affected individual is unable to interpret reality…
Q: Scenario 2 David is 58 and starting to lose things and forget words. Neither of David's parents had…
A: Alzheimer's disease: A degenerative brain disease leading to dementia, which is a gradual loss in…
Q: the results of research on the relationship between telomere length and stress among children living…
A: Telomeres are the end portions of each chromosome that prevents the DNA from any type of damage like…
Q: A scientist discovered a new factor, Sneezy, to be important for the central nervous system…
A: Neural tube defects are birth defects caused by combinations of genetics, environmental factors, or…
Q: Distinguish between Alzheimer's disease (AD), Parkinson's disease (PD) and Huntington's disease (HD)…
A: Alzheimers disease It is a progressive neurological disorder which results in brain to sink and…
Q: Which of the following symptom pairs include both a positive AND negative symptom of schizophrenia?…
A: Psychiatric nursing is also known as the mental health nursing in which the nurse specializes in…
Q: During brain development, the process of synaptogenesis is a crucial one. Which of the following is…
A:
Q: What contributes to obesity among humans today? a. eating more calorie dense foods b.…
A: Obesity is one of the health disorders where abnormal or excessive fat accumulation occurs. A body…
Q: scientist is studying a human disorder that may be attributable to a mutation in the mitochondrial…
A: According to Mendelian inheritance, alleles from both male and female side combines and determines…
Q: How are researches working with extended families inMedellin, Colombia to look for methods of…
A: Alzheimer's disease is a type of progressive brain disorder in which the brain undergoes atrophy and…
Q: The major reason the cortex is so convoluted in humans is . A. to accomadate the…
A: Cortex is the outermost layer of an organ. When present in brain, it is termed as cerebral cortex.…
Q: Describe one connection between the structure of proteins and brain degeneration diseases.
A: Proteins are primarily made up of amino acids. A protein becomes functional when it acquires unique…
Q: Draw a schematic diagram of how we can nonpharmacologically manage the Zollinger Ellison Syndrome?
A: Zollinger Ellison Syndrome his disease is also known as the term Z-E syndrome. This syndrome is…
Q: Propose a theoretical way to cure Down syndrome. Explain why it's theoretical and not practical
A: Answer :: Various key pointers should be kept in mind while dealing with Down Syndrome children. The…
Q: • Match the following terms to the correct explanation.1. Epigenetics2. Molecular behavior…
A: Science is a field that is divided into an infinite number of disciplines and subdisciplines. All…
Q: Should drugs be prescribed to children who have ADHD? What about adults? On what scientific evidence…
A: ADHD refers to the Attention Defecit Hyperactivity disorder , is most common neuro developmental…
Q: Which is NOT a question that science can answer: (a) Does taking ginkgo reduce the chance of…
A: * Gingko biloba is an extract that is obtained from leaves of the Ginkgo biloba tree. * It is…
Q: disorder that leads to nearsightedness (difficulty seeing things at a distance) is caused by a…
A: * given that the disorder nearsightedness is caused by mutation. *On small island of Pacific…
Step by step
Solved in 2 steps
- Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myleoid leukaemia? A. t(8;21) translocaton (RUNX1_RUNX1fusion) B. DNMT3A mutation C. TP53 deletion D. NPM1 mutation.What is the relation of genetics to Alzheimer’s disease? a. Identified genes have a strong effect on early-onset Alzheimer’s disease and a weaker effect on lateonset disease. b. Identified genes have a weak effect on early-onset Alzheimer’s disease and a stronger effect on lateonset disease. c. Identified genes have a strong effect on both the early and late onset forms of Alzheimer’s disease. d. Identified genes have little or no effect on Alzheimer’s disease, regardless of time of onset.Which pathology leads to an increased risk of Alzheimer’s disease? Select one: a. Accumulation of the Amyloid β peptide b. Homozygosity for the e2 ApoE allele c. Sedentary lifestyle in young adulthood d. A mutation in the presenilin 4 gene e. Increase in blood cholesterol
- Which pathology leads to an increased risk of Alzheimer’s disease? Select one: a. Homozygosity for the e3 ApoE allele b. a sedentary life style c. A mutation in the amyloid precursor protein gene d. a diet high in fat and sugars e. Homozygosity for the e4 ApoE alleleMutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A. mucopolysaccharidosis type II B. Turcot syndrome C. Haemophilia A D. Xeroderma pigmentosum E. Haemophilia B F. Ataxia Telangiectasia G. Noonan syndrome H. Li-fraumeni syndrome I. Hunter syndrome J. Ocular motor apraxiaWhich of the following statements are correct about cancer drug resistance (select all that apply)? A. It is inevitable that a tumor will eventually become resistant to a given cancer drug B. Solid tumors often develop drugs resistance through upregulating expression of drug transporters. C. If the probability of develop resistance to drug A is 1/10 and for Drug B is also 1/10, then the probility of developing resistance to Drug A and B combination therapy is 1/20. D. Effective multidrug protocols use 3 drugs that all target the same mechanisms of killing cancer cell E. Drug resistance ofter develops when p53 is inactivated
- Which of the following are mechanisms by which cancer drugs work (select all that apply)? A. Inhibit activity of oncogene B. Promote apoptosis C. Promote terminal differentiation of cells D. Inhibit drug transporters E. Promote DNA damage.Which of the following demonstrates the link between oncogenes and cancer? a.Oncogenes do not have mutations that increase the activity or number of molecules that stimulate mitosis. b.Oncogenes produce molecules that inhibit mitosis. c.They are genes that transform tumor cells into normal cells. d.The mutations in oncogenes increase the activity or number of molecules that stimulate mitosis, leading to irregular cell division.If two mutational events are sufficient to cause some forms of cancer, what distinguishes familial forms (i.e. those that "run in families") of cancer from spontaneous cases? A. spontaneous forms inherit both mutations B. familial forms are caused by chance alone C. familial forms inherit one mutation D. there is no difference E. none of the above
- A medical research firm developed a new test for bipolar disorder that tries to identify if specific series of genome codes are missing in a person's DNA. What is the focus of the firm's test? Select one: a. chorionic villus samples Incorrect b. copy number variations c. diathesis-stress markers d. autosomal mutationsWhich ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myeloid leukaemia Select one: A.t(8;21) translocation (RUNX1‐RUNXT1 fusion) B.DNMT3A mutation C.TP53 deletion D.NPM1 (nucleophosmin) mutationwhat is the correct order of the point mutations? a. bafecd b. fcdbea c. dfaebc d. cbadef e. efcadb