A medical research firm developed a new test for bipolar disorder that tries to identify if specific series of genome codes are missing in a person's DNA. What is the focus

Q: What is the correct order of the gene sequence given the following information: BD - 14% CD - 12% AD…

A: BASIC INFORMATION ABOUT GENETIC MATERIAL  DNA It stands for deoxyribo nucleic acid.  It is the…

Q: Which of the following describes an oncogene Group of answer choices A. a gene that stimulates cell…

A: Cancer is caused by changes in the DNA and is called genetic changes. Cancer is the growth of the…

Q: Please choose the correct answer. Initial DNA nucleotides are added by reverse transcriptase from…

A: Reverse transcriptase is RNA dependent DNA polymerase. It transcribes ssRNA into DNA.

Q: Please help me with the multiple choice question below - it is based on genomics/developmental…

A: The correct answer is E. Transcription factors.

Q: Using hemophilia as an example, discuss how mutations, genetics, and history interact in real-life…

A: Hemophilia It is a common hereditary coagulation blood disorder due to the deficiency or reduced…

Q: Please answer the following questions: 1. What is the role of MinC, MinD, and MinE in bacterial cell…

A: As per bartleby guidelines, only first three questions can be answered. Please post the remaining…

Q: please help with these two questions: 1.De novo gene expression is concentrated in the colon…

A: Infanticide   Infanticide is the killing of newborn.

Q: Chromosomal translocations AND mutations in cadherin binding sites can result in cancer. Select one:…

A: Introduction: When a segment of one chromosome separates and joins another chromosome, the process…

Q: Cystic Fibrosis is caused by a mutation in the CFTR gene, and an ideal form of treatment would be to…

A: Cystic fibrosis is an inherited life threatening disorder that causes severe damages to lungs,…

Q: Which ONE of these is TRUE regarding the aetiology of acute lymphoblastic leukaemia (ALL)? Select…

A: in regarding of the aetiology of Acute Lymphoblastic Leukemia (ALL)

Q: A 20-year-old primigravida gives birth to an infant. The infant had immediate respiratory distress…

A: Introduction:-  Thanatophoric dysplasia is a lethal skeletal dysplasia that is characterized by…

Q: What degree of differences would you expect to see in the DNA base sequences and epigenetic marks of…

A: Monozygotic twins are born due to splitting of one single fertilized egg into two embryos. They are…

Q: Please give the correct answer of the question and properly explain    thank you

A: The first part of the question is asking which group of genes would be more likely to form a…

Q: F1 mice targeted using CRISPR/Cas9 and an HDR DNA fragment is the first choice when modeling a.…

A: During replication, there will be a tiny number of mistakes in the sequence every time this happens.…

Q: What type of database is OMIM?

A: OMIM (Online Mendelian Inheritance in Man) is a daily updated catalog of human genes and genetic…

Q: From the list of answers below (A-D) select the correct answer(s). There may be more than one…

A: Need to find which of the statement is right from the following.

Q: A. Somatic cells are aslo called B. In irder to clone a gene,

A: A Somatic cells are also called Body cells .  Any other cells other than gametes are called somatic…

Q: Explain the connection between the founder and the G8-C marker.

A: In this example the original mutation that caused  the huntington allele occurred in a germline cell…

Q: Which of the following rows correctly identifies the difference between somatic gene therapy and…

A: Somatic therapies target genes in specific types of cells (lung cells, skin cells, blood cells,…

Q: We use the Alu element polymorphism to trace each student's ancestry. This element is present in an…

A: Introduction  Polymorphism refers to the occurrence of multiple genetic variants, or alleles, within…

Q: Breeding two F1 mice heterozygous for a knockout allele will yield a. Knockout mice b.…

A: Dominant allele is expressed in homozygous as well as heterozygous state. In contrast recessive…

Q: F in this picture represents female . C = Children. And M = man. The arrow marked at number 1…

A: A laboratory technique called DNA fingerprinting uses a sample of DNA to identify a person by…

Q: 1. What is an allele? 2. What is a point mutation? 3. How are point mutations related to alleles?

A: A mutation is a sudden heritable change in DNA sequence which corresponds to an altered amino acid…

Q: Go to the NCBI’s website at https://ncbi.nlm.nih.gov On the database dropdown menu, select “Gene”…

A: The RB1 gene (Retinoblastoma 1) is a tumor suppressor gene that is located on chromosome 13. The…

Q: ____________ proliferate by cutting and pasting the original copy to another part of the genome,…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: A defective gene on chromosome 15 causes Tay-Sachs disease. It is a central nervous system…

A: Tay-sachs is an autosomal recessive disease. It occurs due to defective gene on chromosome number…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia is a disease that interferes in the production of normal blood cells. It is a…

Q: 11. Using the hypothetical pathway below, determine what proportion of offspring will be Orange if…

A: In this pathway, the presence of orange colour means the absence of C and the presence of A+ B in…

Q: The first mutation is thought to occur in utero in most cases of ALL diagnosed before age 5 years…

A: Acute Lymphoblastic Leukemia (ALL) is a type of blood cancer that affects white blood cells. It is…

Q: During which stage of translation are the small and large ribosomal subunits recruited? a.…

A: Protein synthesis may be broken down into the same three processes as mRNA synthesis: initiation,…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia (AML) is a kind of blood cancer.

Q: The case of golden labs in which a mutation in a gene for the pigment transport protein results in a…

A: It is given that there are two genes. The first gene encodes the normal pigmentation. The second…

Q: Which ONE of the following genetic patterns defines a patient with acute myeloid leukaemia with the…

A: Any kind of alteration in the nucleotide sequence of an organism’s genome is referred to as a…

Q: Sequencing the human genome, the development of microarray technology, and understanding of complex…

A: Proteomics is the large-scale study of proteins.Proteomics has enabled the identification of ever…

Q: Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene…

A: Mutations in the following gene gives rise to a genetic disorder known as Xeroderma pigmentosum.…

Q: Who should have access to James Lanahan’s gene testing report? Please give reasoning.

A: Huntington’s Disease is a disease that is genetic and is passed from parents to the offspring…

Q: Once created, new combinations of genes will be acted upon by ________________________________

A: New combination of genes are formed either by mutation or by the recombination. New combination of…

Q: Is it possible that Carol may develop Alzheimer's later in life but doesn't show any signs now?…

A: An irreversible, progressive brain disorder that slowly affects the memory, thinking and, ability to…

Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…

A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…

Q: Which BLAST type allows you to compare and find genetic similarities between proteins?   a.…

A: BLAST stands for Basic Local Alignment Search Tool and refers to a set of programmes that build…

Q: Choose the correct answer : Human Papillomaviruses are characterised by all of the following…

A: The HPV is termed as the human papillomavirus. The infection caused by this can be transmitted from…

Q: with Nonpolyposis colorectal cancer and his biopsy pathology report reveals a defect in some TSGs…

A: Non polyposis rectal cancer may have a hereditary origin linked to it as few mutations in certain…

Q: A study was conducted to determine the importance of Nucleoid Associated Proteins (NAPs) by deleting…

A: 1- Nucleoid-associated protein (NAPs): These are small DNA binding proteins which can alter the DNA…

Q: Currently, the only possible cure for genetic disorders is ____.​   a. ​GMOs   b. ​gene therapy…

A: Introduction :- Any disease caused by an aberration in an individual's genetic composition is…

Q: The probe in our telomere experiment was labeled with digoxigenin. What are the advantages of using…

A: Digoxigenin is a small molecule that can be covalently attached to DNA or RNA probes to label them…

Emotions

Emotions are biologically based psychological conditions caused by neurophysiological changes which are linked to different factors such as thoughts, emotions, behavioral responses, and pleasure or displeasure. These emotions are not similar to moods. The mood is an affective state. Mood depends upon several factors, such as weather, the environment, physiology, etc. Emotions can be beneficial or detrimental depending on the situation. Emotional reactions are simple. Emotional well-being is strongly affected by our well-being, and such feelings are private.