Q: Which of the following do you think would be true of the sites of the origin of replication (where…
A: The replication of DNA is the creation of two molecules of DNA from one parent molecules, in which…
Q: The linking of the 5’ end of one Okazaki fragment with the 3’ end of an adjacent Okazaki fragment…
A: The DNA is the genetic material that is passed from one generation to the next generation. It is…
Q: The problem of replicating the lagging strand—that is, adding bases in the 3’ to 5’ direction—is…
A: DNA replication always occurs in the 5' to 3' direction because to extend a nucleotide chain a…
Q: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced…
A: Introduction Genes contains specific nucleotide sequences which can be transcribed into the mRNA by…
Q: A lagging strand forms by (a) joining primers (b) joining Okazakifragments (c) joining leading…
A: Answer is b.) joining okazaki fragments.
Q: The original DNA base sequence is 5’-AGCGTTACCGT-3’; a mutation in the DNA strand results in the…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: How many subunits does the E. coli DNA polymerase I have? Select one: O a. 5 Оb. 10 О с. 1 O d. 3
A: RNA polymerase is required for the transcription of DNA into RNA. It is also important in the study…
Q: The beta subunits of E.coli DNA polymerase III are responsible for its _______. A. ribosome…
A: In prokaryotes, the DNA replication is carried out with the help of various enzymes, like, DNA…
Q: Enzymes isolated from bacteria that cut DNA at specificsequences are called ____________________.
A: Enzymes are biological catalysts which enhance the rate of a reaction without being consumed or…
Q: Which of the following enzymes do not require a DNA template for nucleotide synthesis? *
A: DNA template is a DNA strand which is copied in to a complementary strand of DNA. According to the…
Q: The enzyme responsible for the joining of Okazaki fragments is a. helicase b. primase c. DNA ligase…
A: Okazaki fragments are DNA nucleotides with short sequences having approximately 150 to 200 bps (in…
Q: DNA synthesis has a very low error rate. One reason for this is that the DNA polymerase enzyme can…
A: DNA polymerase is the enzyme that does maximum of the work throughout DNA replication. It builds a…
Q: Describe what happens to the DNA when the helicase unwinds the double helix. What can Topoisomerases…
A: it occurs during DNA replication.
Q: Topoisomerases (a) synthesize DNA (b) synthesize RNA primers(c) join Okazaki fragments (d) break and…
A: The biochemical molecule that is built up with two polynucleotide chains is called DNA…
Q: Which of the following cannot be fixed in the cell and can lead to permanent damage in the DNA?…
A: DNA damage takes place due to various causes. This DNA will ultimately cause conformational changes…
Q: Explain TWO (2) differences between two commonly used ligases; F. coli DNA ligase and T4 DNA ligase.
A: During DNA cloning process , various restriction enzymes like exonucleases and endonuclease as well…
Q: a) What dipeptide is produced from the following segment of DNA: AGAGAT? (b) What happens to the…
A: Gene expression is the process in which information stored in the DNA is converted into the…
Q: What feature of a DNA fragment causes it to move through a gel during electrophoresis? a. the…
A: Introduction: Gel electrophoresis is a molecular technology that helps to separate the DNA fragments…
Q: What is the sequence of the DNA template strand from which each of the following mRNA strands was…
A: As we know that the DNA carries the information, which is translated into the mRNA and transcribed…
Q: The “rungs” of the DNA double helix are held together by a. ionic bonds.b. hydrogen bonds.c.…
A: Introduction: DNA, also known as deoxyribose nucleic acid is made up of nucleotides which comprises…
Q: Which protein or enzyme represents "Single Stranded DNA Binding Proteins"a. A b. B c. C d.
A: DNA replication is an enzymatic process which helps DNA to replicate itself.
Q: Which of the following is most relevant to the term "hybridization"? a) base pairing b) nuclease c)…
A: Hybridization is to combine two substances to make a hybrid. In molecular biology, Hybridization is…
Q: If a restriction enzyme cuts between the G and the A whenever itencounters the sequence GAATTC, how…
A: Answer is c.) four.
Q: DNA strands that can form a double helix are said to be Select an answer and submit. For keyboard…
A: Deoxyribose Nucleic Acid or DNA is a double-stranded molecule with the shape of a twisted ladder.
Q: The following enzymes cannot catalyze the synthesis of DNA A.DNA polymerase B.DNA gyrase…
A: DNA is the genetic material of an organism. DNA replication is a process in which two DNA molecules…
Q: Regarding the diagram below, this enzyme is responsible for creating an exact replica of DNA in one…
A: DNA replication is the process of replication of the DNA material in a semi-conservative manner.…
Q: DNA double helix is stabilized by ... a) H-bonds between the sugar-phosphate backbones. b)…
A: Answer. Watson and Crick first describe the structure of DNA double helix in 1953 e using x-ray…
Q: In which region(s) will Okazaki fragments be found during new strand synthesis? (see image for…
A: Semi replicative mechanism is a type of DNA mechanism which explained the type of replication…
Q: Describe the activities of the enzymes required to construct a recombinant DNA molecule.
A: Genetic engineering is the major area for the production of recombinant DNA. The recombinant DNA is…
Q: Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b)…
A: Restriction endonucleases may cut DNA. The ends of the DNA may be blunt or sticky. A straight cut…
Q: Which of the following represents a base analog acting as a mutagen? O ethidium bromide O guanine O…
A: In hereditary qualities, a mutagen is a physical or compound specialist that changes the hereditary…
Q: identify the type of DNA binding motif is shown and the characteristics.
A: DNA stands for deoxyribonucleic acid. A DNA-binding domain consists of a structural motif that…
Q: 1. Photoreactivation destroys the covalent bond by using the light energy from the UV light source…
A: Photoreactivation is the mechanism of DNA repair. This is a light-dependent repair mechanism. It…
Q: All transposons would have these components among A- D EXC A) O transposase B) O insertion sequences…
A: Transposable elements are those DNA sequences that move from one location on the genome to…
Q: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What MRNA would be produced…
A: The transcription process enables an enzyme known as RNA polymerase to bind to the DNA and break…
Q: The A and B forms of DNA A both have 12 base pairs per turn of the helix B are both right handed…
A: DNA or deoxyribonucleic acid is a polymer made up of nucleotides. It is present in a double-stranded…
Q: The Watson-Crick double helix immediately suggested that DNA is replicated in a manner. a. semi…
A: The genetic material is transmitted to the next generation through DNA. A cell leads to several more…
Q: After using the blender to blend the split peas, water, and salt mixture, cheesecloth is used to. .…
A: It is a cotton cloth that is loosely woven and resembles gauze.
Q: Type the matching bases below in each DNA sequences. A T T C G A C G T C
A: DNA sequence composed of a row of chemical building blocks - called "bases". There are four types of…
Q: . Which of the following statements best describe the mismatch repair pathway?a. It is part of the…
A: DNA polymerases include a group of enzymes that are responsible for the synthesis of DNA during DNA…
Q: a) What is the sequence of the copy and the template strands? b) If the template strand were in the…
A: A DNA primer complementary to the template DNA (the DNA to be sequenced) is used as a starting point…
Q: The formation of pyrimidine dimers results from which of the following? a. Spontaneous errors by…
A: Pyrimidine dimers cause mutations in the DNA. When two thymine residues in the same strand form…
Q: The problem of synthesizing the lagging strand, in the sense that DNA synthesis can only occur in…
A: DNA synthesis is the formation of new DNA molecules from the parental strand by utilizing…
Q: Suppose, a group of scientists developed a recombinant enzyme having mutations in its active site.…
A: The active site is a groove or pocket formed by the folding pattern of the protein.
Q: Once you had your DNA sample extracted from your cells, why did we add the yellow Master Mix…
A: The DNA sample extracted from the cells is amplified using a method called the Polymerase Chain…
Q: Define the following terms: a. nonreplicative transposition b. transposable element c. bacterial…
A: Horizontal gene transfer or lateral gene transfer is a genetic transfer method by which the genetic…
Q: #1: 3’ T A C A T G C C G A A T G C C 5’ #2: 3' T A C T…
A: The mRNA is produced from the DNA by the process of transcription and proteins are produced from the…
Q: The use of dideoxynucleotide triphosphates in the Sanger method facilitates sequencing of…
A: DNA sequencing is the technique of determining the sequence of individual nucleotides in a gene or…
Q: From an extract of human cell growing in tissue culture, A fibrous substance was obtained. How would…
A: Introduction: The primary structure of both DNA and RNA are similar. Each consists of a…
Q: Make a drawing that shows how alkylating agents alter the structureof DNA, and explain the process.
A: To draw How alkylating agents alter the structure of DNA
Which of the following does the enzyme primase
synthesize?
a. DNA primer
b. RNA primer
c. Okazaki fragments
d. phosphodiester linkage
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- How many kilobases of the DNA strand below will code for the protein product?The enzyme that removes RNA primers attached by Primase is?Which of the following types of enzymes is primarily responsible for setting up the genetic code? 1.) Kinases 2.) DNA ligase 3.) DNA gyrase 4.) peptidyl transferase 5.) aminoacyl tRNA synthetases (charging enzymes)
- Why is Sanger sequencing referred to as the chain termination method? Select one: a. Sugars on ddNTP lack 3' OH, which prevents the binding of the next nucleotide b. Sugars on the ddNTP have an OH in the 3', which catalyzes the cleavage of phosphodiester bonds c. Sugars on ddNTP lack 5' OH, which prevents the binding of the next nucleotide d. Bases on ddNTP lack 3'OH, which prevents the binding of the next nucleotide Bases on ddNTP lack 5' OH, which catalyzes the cleavage of the phosphodiester bond е.The following fragment of DNA is from the template strand. First determine the amino acids of the protein encoded by this sequence by using the table at the end of this document. Then give the altered amino acid sequence of the proteins that will be found in each of the following mutations: 3’ – TAC AAG GCT CTA TTT GCC ACA ATC – 5’ The nucleotides are numbered 1-24 from left to right. Mutant 1: A transition at nucleotide 9 Mutant 2: A transition at nucleotide 11 Mutant 3: A T to A transversion at nucleotide 15 Mutant 4: A one-nucleotide deletion at nucleotide 7 Mutant 5: A transition at nucleotide 13 Mutant 6: An addition of GGA after nucleotide 6The template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?
- Ribonuclease A cannot catalyze the hydrolysis of DNA. which of the following statements explains it. a. Ribonuclease requires two active site histidines to be active but the nucleobase of DNA will form hydrogen bonds with these histidines and block their acid-base catalysis. b. DNAs have thymidine that is more stable than the uracil in RNAs c. DNAs are double-stranded and the nucleobases are protected while RNAs are single stranded d. DNAs does not have hydroxyl group at 2' position of the sugar ring to support the catalysisConsider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand (sense strand) 5' 3' ATACTTTCA transcribed strand In the space below, write ONE of the possible DNA sequences of the transcribed strand shown above that results from BOTH a single substitution mutation of the first codon following the start codon that would also cause a nonsense mutation. Use the mRNA codon chart in the Appendix of your manual to help you. Answer: CheckAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
- For the following sequence of amino acids, serine-valine-lysine-leucine, which of the choices below is the correct order for the nucleotide base sequence in DNA? Group of answer choices a. UGUGCAAAGUUA b. AGACAATTCAAT c. TCTCGTTTGTTA d. TGTGCTTTCTTAGive the corresponding strand of the DNA having the sequence of:a. 5’ ATGGCTAGGATCGGTAACTGCGATCGATCAGCATGACTAG-3’b. 3’ TACCAGGATAATTCGAGGTACTACGACTAGGAT-5’c. 5’ AACATGATCTGGTCCATTAGCTTGTTCAATAATTAGC-3’One common type of non-homologous end joining, to repair a double stranded break, occurs when enzymes cut out a few nucleotides around the break, and then fuse the ends back together true or false?