If a restriction enzyme cuts between the G and the A whenever itencounters the sequence GAATTC, how many fragments will beproduced when the enzyme is digested with DNA with the followingsequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGCa. Two c. Fourb. Three d. Five

Use the diagram to answer the following three questions. 5' TTAGGGITAGGGTTAG 3' ||||| 3' AATCCC 5' -Telomerase ČAAUCCCAAUC RNA of telomerase- 3' 5' Write the next six bases that would be added by telomerase using the format 5'NNNNNN3' What does the "RT" stand for in the protein known as TERT (two words)? In order to add more than six bases what must the telomerase do first?

A linear DNA has two sites for a particular restriction enzyme. How may fragments are produced in a complete digestion? Group of answer choices 1 2 4 3

A scientist wants to amplify a short region of the DNA molecule shown below inside the box. Pick the PAIR of primers that can be used in a polymerase chain reaction (PCR) to amplify this fragment 5'TCTTCAAATGTCATCAAAGTGCCACTAGAAAAGAACTCATCGAATACTGAACAACTGTTAAAAAAGCAAAAAATTCTAA 3'AGAAGTTTACAGTAGTTTCACGGTGATCTTTTCTTGAGTAGCTTATGACTTGTTGACAATTTTTTCGTTTTTTAAGATT 5' CAGTTGTT 3' 1. 2. 5' GTTCTTTT 3' 5' AAAAGAAC 3' 3. What is the sequence of 5' TAGAATTT 3' 4. the primer that initiates synthesis of the bottom 5' AACAACTG 3' 5. strand of the indicated DNA region? 5' CAAATGTC 3' 6. What is the sequence of the primer that initiates 7. 5' GTTTACAG 3' synthesis of the top strand of the indicated 5' TTTTCTTG 3' 8. DNA region? 9. 5' TTGTTGAC 3' 5' GTCAACAA 3' 10. 11. 5'ATCTTAAA 3'

obtain micro centrifuge tubes that contain each enzyme stock solution. digest the lambda DNA with a specific restriction enzyme. incubate the mixture of DNA and enzyme run the restriction digested DNA with loading dye in the agarose gel analyze the DNA fragments A. 4th event B. 2nd event C. 1st event D. 3rd event E. 5th event

1. Use the prokaryotic gene DNA sequence below to answer the following questions: 1 11 21 ATGAAGCTAC 51 TTTGCCCAGG 101 ACATCTGACA 61 TTTGACAGTC TTCTATCGAA CAAGCATATA ATCAGCGATA 71 111 31 121 AGGTTTAACA ACATGTCAAG TGCTCCAAAG AAAAACCGAA 81 141 GGGAAAAAAT CCCCCCCCCC TTTTTTTTTTTTTTTTCCCG d. Where is the 3' UTR? Circle one. 12-72 35-72 131 109-146 41 a. Write the corresponding sequences, circle & label them in the sequence above: -35 consensus sequence: (label as -35) -10 consensus sequence (Pribnow box): Shine-Delgarno sequence in the corresponding mRNA: Start (initiation) codon in the corresponding mRNA: Stop (termination) codon in the corresponding mRNA: (label as PB) 91 c. What will be the nascent polypeptide sequence translated from this mRNA? (label as SD) (label as start) b. What region of this prokaryotic DNA sequence will be transcribed into mRNA? Circle one. 1-120 35-108 54-146 72-146 (label as stop) 121-146